Николаев лечебное голодание: “Осторожно, люди!»: день из жизни, голодание и здоровье

Содержание

“Осторожно, люди!»: день из жизни, голодание и здоровье

  • Сева Новгородцев
  • Би-би-си, Лондон

Став рядовым, я решил на досуге заняться собой.

Разговоры о некоем универсальном методе я слышал среди джазменов еще в 1969 году. Тогда в Москве вышел сборник «Проблемы лечебного голодания». В нем приняли участие крупные советские ученые: академик П. К. Анохин, академики А. А. Покровский и П. А. Федоров, профессор Ю. С. Николаев и разные светила из-за границы.

В 1973 году появилась книга Николаева и Нилова «Голодание ради здоровья», тираж в 200 тысяч был мгновенно раскуплен. Одну книжечку я сумел достать и теперь прилежно ее изучал.

Николаев Юрий Сергеевич (1905–1998) — доктор медицинских наук, профессор, сделавший большой вклад в в советскую медицину, популяризатор метода разгрузочно-диетической терапии (РДТ).

О лечении голоданием семье Николаевых стало известно от Эптона Синклера — американского писателя, автора книги Fasting Cure, которая по-русски называется «Лечебное голодание»; название можно перевести также как «Лечение постом».

Отец Юрия, Сергей Дмитриевич, вел активную переписку с Синклером. Мать Юрия, Лариса Дмитриевна, открыла в Москве вегетарианскую столовую.

Ее книга «Сто вегетарианских блюд» начиналась эпиграфом из Георга Фридриха Даумера: «До тех пор, пока будет существовать система убийства животных и поедание трупов как общепринятый обычай, для человечества не может наступить период истиной культуры».

В 1960 году Юрий Николаев защитил в Институте высшей нервной деятельности докторскую диссертацию на тему «Разгрузочно-диетическая терапия шизофрении и ее физиологическое обоснование».

Позже РДТ стала успешно применяться Николаевым и его учениками также и для лечения многих соматических болезней, считавшихся неизлечимыми.

Вкратце методика Николаева сводилась к четырем главным пунктам: ежедневно совершать длинные прогулки (5 км) на свежем воздухе, пить два литра чистой (кипяченой) воды, принимать горячие ванны с мытьем мочалкой (для массажа) и очищать кишечник кружкой Эсмарха (подвесной клизмой). Остальное просто — не есть.

К голоданию надо готовиться, постепенно уменьшая объем еды; в последнюю ночь принять слабительное. Начинать с одних суток, потом голодать три дня, после перерыва — неделю, а там и дальше можно двигаться.

После пяти-семи дней наступает так называемый «ацидоз» от человека пахнет псиной, после десяти дней отключается пищеварение, уходит острый голод.

В организме проходят интенсивные мобилизационные и восстановительные процессы, идет естественное лечение всех болячек.

Самого главного в книжке Николаева не было, да и быть не могло. У классиков, скажем, у Эптона Синклера, речь идет не о голодании, а о посте, где отсутствие пищи физической возмещается обилием пищи духовной.

Впрочем, даже если бы случилось чудо, и советский Главлит пропустил бы идею поста и молитвы, вряд ли кто-нибудь из нас мог тогда воспользоваться такой методой.

В космос летали ракеты, повсюду висели портреты космонавтов, физики спорили с лириками. Мы были невольными материалистами, и голодание ради здоровья было нашим пределом духовности.

Другие материалы в этом блоге:

Читать «Голодание ради здоровья» — Черкасов Владимир, Николаев Юрий Сергеевич, Нилов Евгений Ильич — Страница 1

Ю.С. Николаев, Е.И. Нилов, В.Г. Черкасов

Голодание ради здоровья

ПРЕДИСЛОВИЕ

Предлагаемая вниманию читателей книга посвящена интересному и важному вопросу о лечении ряда психических и соматических заболеваний методом дозированного голодания, или, точнее, — разгрузочно-диетической терапии (РДТ). Это уже второе, переработанное и дополненное издание книги Ю. С. Николаева и Е. И. Нилова «Голодание ради здоровья». Первое вышло в 1973 г. тиражом 200 000 экземпляров и быстро разошлось, вызвав большой интерес как у широкого круга читателей, так и у медиков. В настоящем втором издании внесены изменения в главу «Внутренний врач», где авторами дано новое воззрение на ацидоз. Заново написаны главы «Голодайте на здоровье» и «На разных меридианах».

Авторы развивают свой взгляд на голод и голодание. Они отмечают, что голод как социальное явление — это большое бедствие, могущее привести к истощению и смерти. Однако в руках людей, знающих и умеющих им пользоваться, он может стать сильным биологическим средством, которое позволяет избавить больных от разных заболеваний, не поддающихся лечению распространенными в медицине медикаментами и другими средствами. Между тем в настоящее время существуют и противники этого метода, отрицающие возможность его применения для терапии. К тому же далеко не все врачи знают, как использовать метод дозированного голодания в лечебных целях. Авторы показывают, что если овладеть методом, то результатом лечения будет отнюдь не истощение и смерть, а восстановление здоровья и продление жизни у тяжелобольных людей.

В книге помещен интересный очерк истории вопроса, в котором показывается, что лечение голодом было известно еще в глубокой древности. Авторы, совершив своеобразное путешествие, приводят много интереснейших данных, представляющих интерес не только для широкого круга читателей, но и для врачей разного профиля. Они убедительно показывают, что нет никаких оснований рассматривать этот метод как новый, неизученный и тем более опасный. Неправильно ставить метод под сомнение и даже отрицать его без собственного клинического опыта. В настоящее время положительные результаты лечения голоданием подтверждены на десятках тысяч больных во всем мире. В Советском Союзе метод РДТ с успехом применяется в ряде больниц и институтов Москвы, Ленинграда, Минска, Ташкента, Киева, Харькова, Кривого Рога и др.

Большим вкладом в развитие метода явился вышедший в Москве в 1969 г. сборник «Проблемы лечебного голодания». В нём приняли участие крупные учёные: академик П. К. Анохин, академики АМН СССР А. А.

Покровский и П. А. Федоров, профессор Ю. С. Николаев. Серьезного внимания заслуживают также монографии ряда зарубежных учёных. Все эти авторы на большом статистически достоверном материале подтверждают высокую эффективность метода.

По решению президиума АМН СССР и президиума Ученого совета Министерства здравоохранения СССР в 1987 г. проведена Всесоюзная научно-практическая конференция по проблеме применения РДТ в клинической практике. В институте питания АМН СССР с 1986-го по 1988 г, осуществляется специальное исследование по механизму действия голодания на организм.

Следует подчеркнуть, что как терапевтическое средство голодание всегда должно быть дозированным, не доводящим человека до полного истощения. Поэтому профессор Ю. С. Николаев указывает, что применяемый им метод является не просто лечебным голоданием, а разгрузочно-диетической терапией, включающей в себя ряд процедур, способствующих выведению из организма токсических продуктов (очистительные клизмы, душ, массаж, длительные прогулки на свежем воздухе, дыхательная гимнастика и др.

). Период голодания сопровождается равным ему по времени периодом восстановления.

РДТ — это неспецифический, т. е. биологический общеоздоровительный, метод, мобилизующий и повышающий защитные силы организма, что дает возможность использовать его для лечения широкого круга заболеваний, в том числе соматических — сердечно-сосудистых, желудочно-кишечных, болезней суставов, органов дыхания, кожных, аллергии, ожирения и др. Профессор Ю. С. Николаев с успехом стал применять метод РДТ для лечения и возвращения к работе и жизни людей с рядом психических болезней — вялотекущей формой шизофрении, некоторыми неврозами и др. РДТ дала также положительные результаты при лечении болезни Бехтерева.

В книге достаточно подробно описана методика РДТ и рекомендуемая при этом диета. Приведены некоторые весьма выразительные и впечатляющие примеры лечения психических больных. Вместе с тем профессор Ю. С. Николаев постоянно предостерегает от представления, будто метод РДТ — это панацея от всех болезней. Более того, он подчеркивает, что лечебное голодание противопоказано в ряде случаев. Настойчиво предупреждает он также, что несведущим людям нельзя заниматься самолечением, что РДТ должно проводиться под наблюдением врачей.

Весьма важен вопрос о сущности метода РДТ. Дозированное голодание приводит к резкому усилению диссимиляторных процессов, к разрушению и выведению из организмов всех излишков, шлаков, всего того, что засоряет его, мешает нормальной жизнедеятельности. Это касается прежде всего патологических отложений и образований, например, отложений солей, избытка жира, токсичных продуктов обмена и др. Освобождаясь от шлаков, организм переходит на эндогенное питание за счет разрушения собственных жиров, углеводов и белков определенных органов и тканей, но практически не затрагивает такие жизненно важные органы, как сердце и мозг. Этот процесс усиленного разрушения тканей, клеток и молекул сопровождается усилением восстановительных процессов на молекулярном, клеточном и тканевом уровнях и приводит к обновлению и как бы омоложению всего организма и всех его органов.

Поэтому есть основание считать метод РДТ методом стимуляции физиологической регенерации. Этот метод полностью согласуется с данными учения о регенерации, которое также во всех случаях репаративной и физиологической регенерации имеет две фазы: разрушение и восстановление. В обоих случаях фаза разрушения характеризуется преобладанием распада белка и нуклеиновых кислот над синтезом, переходом аэробного дыхания на гликолиз, сдвигом показателя рН в кислую сторону, ацидозом. Фаза восстановления в том и другом случае характеризуется преобладанием синтеза белков и нуклеиновых кислот над их распадом, переходом к аэробному дыханию с гликолиза, возвращением рН к нейтральному состоянию, исчезновением ацидоза и др. Ацидоз при голодании, как указывают авторы, вызывает восстановительные процессы, в частности, способствует фиксации клетками организма СО2 воздуха, углерод СО2 при этом преобразуется в углерод органических соединений; лучше происходит карбоксилирование нуклеиновых кислот, что, в свою очередь, обеспечивает полноценный синтез аминокислот и других соединений белка.
Таким образом, лечебное голодание можно рассматривать как естественный фактор стимуляции физиологической регенерации, приводящей к обновлению и омоложению клеток, тканей, молекул и химического состава целого организма.

Метод РДТ, как справедливо отмечается в книге, с успехом может применяться не только для лечения, но и для профилактики заболеваний, более того — для продления работоспособности и продолжительности жизни людей и животных. Очень выразителен пример с образом жизни и долголетия у людей племени хунза на севере Индии. Люди этого племени живут до 110–120 лет, сохраняя работоспособность. При этом они ежегодно голодают по два месяца и питаются богатой витаминами растительной пищей, в особенности абрикосами.

В заключительной главе книги дан интересный обзор того, что делается в настоящее время в разных странах, «на разных меридианах» нашей планеты при применении метода лечебного голодания.

Профессор Ю. С. Николаев с основанием ставит вопрос о необходимости создания в Советском Союзе центра по лечению ряда соматических и психических заболеваний методом РДТ, где проводились бы научно-исследовательская и клиническая работы.

Голодание ради здоровья : забытые достижения советской меди…

Николаев, Ю. С.

Автор этой книги — доктор медицинских наук Юрий Сергеевич Николаев — является основателем метода разгрузочно-диетической терапии (РДТ), называемого также лечебным голоданием. Результаты излечения болезней удивительно высоки и превосходят успехи всех других терапевтических методов. Прочитав эту настоящую азбуку лечебного голодания, вы измените ваш взгляд на собственный организм.

Полная информация о книге

  • Вид товара:Книги
  • Рубрика:Лечебное (оздоровительное) питание
  • Целевое назначение:Научно-популярное издание для взрослых
  • ISBN:978-5-907172-58-6
  • Серия:Несерийное издание
  • Издательство: Концептуал
  • Год издания:2019
  • Количество страниц:285
  • Формат:60х90/16
  • УДК:613. 24
  • Штрихкод:9785907172586
  • Переплет:в пер.
  • Сведения об ответственности:Ю. С. Николаев, Е. И. Нилов, В. Г. Черкасов
  • Код товара:2453760

Николаев, Юрий Сергеевич

Пользователи также искали:

голодание форум, голодание ради здоровья аудиокнига, голодание ради здоровья форум, клиника николаева голодание, книга николаева голодание ради здоровья читать, лечебное голодание, разгрузочно диетическая терапия николаев, юрий сергеевич николаев от чего умер, голодание, Николаев, николаев, ради, здоровья, Юрий, юрий, форум, николаева, Сергеевич, клиника николаева голодание, лечебное голодание, голодание форум, разгрузочно, диетическая, терапия, клиника, сергеевич, чего, умер, аудиокнига, лечебное, читать, книга, Николаев Юрий Сергеевич, голодание ради здоровья форум, юрий сергеевич николаев от чего умер, голодание ради здоровья аудиокнига, разгрузочно диетическая терапия николаев, книга николаева голодание ради здоровья читать,

Лечебное голодание в психиатрической практике Ю.

С. НИКОЛАЕВ (Москва)

Читайте также

Гипноз, внушение и психотерапия и их лечебное значение

Гипноз, внушение и психотерапия и их лечебное значение …Между прочим, внушение играло роль и при гаданиях древних, особенно же в прорицаниях. Указания на пользование внушением можно найти, между прочим, и в книгах Ветхого завета.В последнее время гиппологическая

Как применить полученную информацию на практике

Как применить полученную информацию на практике Я понимаю, что все изложенное выше изобилует деталями, в которых весьма сложно разобраться; однако мне хотелось представить достаточно большой объем информации по такому сложнейшему вопросу, как вакцинация. Специальные

Применение витаминов в клинической практике

Применение витаминов в клинической практике Применение витаминов в профилактических и лечебных целях можно систематизировать следующим образом. В профилактических целях:1. Профилактика первичных гипо-авитаминозов, обусловленных:• недостаточным поступлением

2. Старые и ошибочные догмы в практике аллопатической медицины

2. Старые и ошибочные догмы в практике аллопатической медицины В университетах, к примеру, профессора учат студентов тому, что материнская клетка порождает две похожие и активные клетки-дочери. Это неверно. Из двух родившихся клеток только одна клетка-дочка становится

5.2. Дополнительная техника, используемая в практике пранаямы

5.2. Дополнительная техника, используемая в практике пранаямы Перед началом практики пранаямы нам следует узнать о трех видах техник, дополнительно используемых при выполнении пранаямы. Это мудры, бандхи и кумбхака – так они называются на

Развитие идей лечебного голодания Ю.

С. НИКОЛАЕВ (Москва)

Развитие идей лечебного голодания Ю. С. НИКОЛАЕВ (Москва) Можно считать, что люди еще с доисторических времен применяли голодание с лечебной целью; это подтверждается наблюдениями за животными, которые при заболевании отказываются от приема пищи, этому же инстинктивно

Результаты разгрузочно-диетической терапии психически больных с синдромом дисморфофобии Ю. С. НИКОЛАЕВ, Г. И. БАБЕНКОВ (Москва)

Результаты разгрузочно-диетической терапии психически больных с синдромом дисморфофобии Ю. С. НИКОЛАЕВ, Г. И. БАБЕНКОВ (Москва) Синдром дисморфофобии с давних пор привлекает внимание психиатров, как отечественных (3—15), так и зарубежных: (1,2, 16—18).Мнение о прогностической

Опыт лечения тучности методом полного голодания Д.

Д. ФЕДОТОВ, Ю. С. НИКОЛАЕВ, Ю. Л. ШАПИРО, Г. И. БАБЕНКОВ, В. Б. ГУРВИЧ (Москва)

Опыт лечения тучности методом полного голодания Д. Д. ФЕДОТОВ, Ю. С. НИКОЛАЕВ, Ю. Л. ШАПИРО, Г. И. БАБЕНКОВ, В. Б. ГУРВИЧ (Москва) Лечение ожирения остается одной из наиболее актуальных проблем современной медицины. Число больных с избыточным весом, согласно данным многих

Лечебное голодание при остром панкреатите А. С. ТАРАСОВА, П. И. ОСТРИН (Москва)

Лечебное голодание при остром панкреатите А. С. ТАРАСОВА, П. И. ОСТРИН (Москва) Острый панкреатит за последние годы все чаще встречается в клинике. В связи с этим изучение методов лечения и вопросы тактики при этом заболевании становятся все более актуальными. Многие

Особенности подвижности основных нервных процессов у больных с различными психическими заболеваниями в процессе лечения их дозированным голоданием Ю.

С. НИКОЛАЕВ, В. А. БРЮЗГИН, В. Б, ГУРВИЧ (Москва)

Особенности подвижности основных нервных процессов у больных с различными психическими заболеваниями в процессе лечения их дозированным голоданием Ю. С. НИКОЛАЕВ, В. А. БРЮЗГИН, В. Б, ГУРВИЧ (Москва) В ряде предыдущих сообщений было высказано мнение, что при лечении

Фагоцитарная активность лейкоцитов периферической крови при полном голодании и последующем питании людей Ю. Л. ШАПИРО, Ю. С. НИКОЛАЕВ, А Я. ТАБАХ, Л. Ф. ЛЕВИНА (Москва)

Фагоцитарная активность лейкоцитов периферической крови при полном голодании и последующем питании людей Ю. Л. ШАПИРО, Ю. С. НИКОЛАЕВ, А Я. ТАБАХ, Л. Ф. ЛЕВИНА (Москва) Изучению фагоцитарной активности лейкоцитов при длительном полном алиментарном голодании посвящены

К вопросу о реакции различных форм ожирения на голодание Д.

Д. ФЕДОТОВ, Ю. Л. ШАПИРО, Ф. А. ВАЙНДРУХ (Москва)

К вопросу о реакции различных форм ожирения на голодание Д. Д. ФЕДОТОВ, Ю. Л. ШАПИРО, Ф. А. ВАЙНДРУХ (Москва) Ожирение, как и вообще проблема неправильного питания, становится в последнее время все более актуальной.В то время, как большая часть человечества (по данным ВОЗа —

СОСТОЯНИЕ ИММУНОБИОЛОГИЧЕСКОЙ РЕАКТИВНОСТИ ОРГАНИЗМА ЧЕЛОВЕКА ПРИ ПОЛНОМ ДЛИТЕЛЬНОМ ГОЛОДАНИИ Ю. С. НИКОЛАЕВ, В. А. СКОРИК-СКВОРЦОВА (Москва)

СОСТОЯНИЕ ИММУНОБИОЛОГИЧЕСКОЙ РЕАКТИВНОСТИ ОРГАНИЗМА ЧЕЛОВЕКА ПРИ ПОЛНОМ ДЛИТЕЛЬНОМ ГОЛОДАНИИ Ю. С. НИКОЛАЕВ, В. А. СКОРИК-СКВОРЦОВА (Москва) Изучение состояния иммунобиологической реактивности организма в период длительного полного голодания и последующего

Материалы к изучению ферментной адаптации при полном лечебном голодании А.

А. ПОКРОВСКИЙ, Ю. С. НИКОЛАЕВ, Г. К. ПЯТНИЦКАЯ, Г. И. БАБЕНКОВ (Москва)

Материалы к изучению ферментной адаптации при полном лечебном голодании А. А. ПОКРОВСКИЙ, Ю. С. НИКОЛАЕВ, Г. К. ПЯТНИЦКАЯ, Г. И. БАБЕНКОВ (Москва) В течение последних лет в нашей стране и за рубежом появилось большое число сторонников применения голодания с лечебной целью при

Некоторые данные относительно белково-азотистого обмена в процессе лечебного голодания психически больных Л. И. ЛАНДО, Ю. С. НИКОЛАЕВ, Ю. Л. ШАПИРО, Г. Я. БАБЕНКОВ (Москва)

Некоторые данные относительно белково-азотистого обмена в процессе лечебного голодания психически больных Л. И. ЛАНДО, Ю. С. НИКОЛАЕВ, Ю. Л. ШАПИРО, Г. Я. БАБЕНКОВ (Москва) Белково-азотистый обмен при полном алиментарном голодании как в эксперименте на животных, так и у людей

Интервью с Юрием Сергеевичем Николаевым, убежденным приверженцем метода лечебного голодания

Интервью с прекрасным врачом доктором медицинских наук профессором Юрием Сергеевичем Николаевым, убежденным приверженцем метода лечебного голодания, ныне покойным, опубликованное в журнале «Предупреждение» № 1, за 1999 год. Напомню, что этот замечательный человек и прекрасный врач умер на 94-м году жизни.

Беседовал с профессором Ю.С.Николаевым известный спортивный журналист и создатель журнала «Предупреждение» А.М.Коршунов. Это интервью состоялось давно, когда профессору Ю.С.Николаеву было 82 года, частично было опубликовано в «Советском спорте» и долгое время пролежало невостребованным. Итак… Метод старый, как мир Мне давно хотелось встретиться с доктором медицинских наук профессором Юрием Сергеевичем Николаевым — замечательным врачом и убежденным приверженцем метода лечебного голодания.

На встрече этой настаивали многие читатели, которых все более и более интересуют проблемы питания, организация разгрузочных дней, 24- и 36-часового голодания, вегетарианства.

Пропаганда здорового образа жизни, хотя и не в той мере, как хотелось бы, приносит свои плоды: ныне все жаждут постройнеть, подтянуться, избавиться от лишних килограммов, лучше познать себя, овладеть естественными методами оздоровления. Отсюда и повышенный интерес к нетрадиционным оздоровительным системам и методикам. Словом, идея встречи витала в воздухе. И вот я на московской улице Юных ленинцев, поднимаюсь по лестнице старой пятиэтажки. Юрию Сергеевичу 82 года. Он высок, худощав.

Так и хочется сказать — неестественно худощав. Убежден, соотношение роста и веса у профессора далеко не соответствует известной формуле Брока. И он тихо говорит. Настолько тихо, что приходится напрягаться, вслушиваясь. Сейчас, мысленно возвращаясь к началу нашей беседы, думаю, она не очень-то удалась. Возможно потому, что доктор Николаев решительно предупредил: «Только давайте сразу условимся: никаких сенсаций, никаких историй о чудо-исцелениях.

Я меньше всего хочу говорить о лечении голодом, ибо оно должно проводиться в стационаре и под наблюдением врача. — Но, может быть, мы поговорим о краткосрочном голодании как о профилактической мере? Есть ли в нем смысл? Вслед за вопросом последовало что-то вроде лекции на тот предмет, что мы все переедаем. В результате 30% населения страдают едва ли не ожирением. Избыточный же вес имеет большинство людей…

Перелом в разговоре наступил после того, как я, напряженно вслушиваясь в тихую речь Николаева, спросил:
— Я Вас не утомляю, профессор?
-Нет, нет, — поспешил заверить Юрий Сергеевич, — просто сегодня 8-й день, как я голодаю.
— Восьмой?! — Восьмой.
-А когда конец?
-Еще два дня…
-И Вы ничего не едите?
-Да, только пью кипяченую воду. Сколько хочется.
-Но это очень, наверное, тяжело. Часто Вы так?..
-Раз в три месяца обязательно. Ну, а краткосрочные голодания — сутки или 36 часов — по потребности.
Как правило, раз в неделю.
-Что значит — «по потребности»? Вы что, временами испытываете желание голодать?
-Именно так, сколь бы невероятным это вам ни показалось. Я живо представляю, что происходит в моем организме в результате метаболизма — превращения веществ на клеточном уровне. Я как бы вижу и ощущаю все шлаки и отходы. И наступает момент, когда мне хочется голодать. Это вошло в привычку.
-В такие дни Вы меняете образ жизни?
-Если речь идет о краткосрочном голодании, то нет.
Продолжаю работать, как работал. Много хожу. Утром обычная гимнастика, бег…
-Вы бегаете?
-А что здесь удивительного? Это прекрасное упражнение.
-Ну, все-таки…
-Вас смущает мой возраст. Еще лет десять назад я бегал очень много — до 2-х часов в тренировку. Правда, в невысоком темпе — я сторонник умеренных нагрузок. Сейчас, в свои 82, я продолжаю регулярные занятия, но время пробежек сократил до 30-40 минут. И еще я приверженец парной русской бани.

Мы собираемся по средам — три профессора, мои последователи, — и неистово паримся. По нескольку раз заходим на полок, после каждого захода — бассейн с холодной водой, затем наш фирменный массаж щетками. Словом паримся основательно. Я сижу в тесной комнате-кабинете напротив профессора. В комнате все напоминает о времени. Старая простая мебель, старые фотографии, полки со старыми книгами…

Напротив меня, чуть привалившись боком к стене — Юрий Сергеевич Николаев — 82-летний человек, который голодает восьмой день. Часто звонит телефон. Профессор устало поднимает трубку, неторопливо и без эмоций с кем-то говорит. На чем мы остановились? — неизменно обращается после телефонного разговора ко мне и сам же, не дожидаясь моего ответа, продолжает прерванную звонком тему. Так, постепенно подобрались мы к 24-часовому голоданию.

Я рассказал профессору историю с публикацией небольшого отрывка из книги Поля Брэгга «Чудо голодания». Мне казалось, отрывок вызовет широкий читательский отклик, но пришло всего два письма. Авторы их сердито сетовали на неудачу — оба, попробовав поголодать по рецепту Брэгга, испытали весьма неприятные ощущения и изрядно перепугались.

-Чепуха, — усмехнулся Николаев. — Краткосрочные голодания показаны абсолютно всем людям и не могут принести вреда. Если, конечно, соблюдать элементарные правила.

-А что это за правила? -Их не так уж и много, и они весьма просты. За день до голодания я бы советовал обязательно перейти на молочно-растительную диету. Хороши также каши — гречневая, пшенная, овсяная, геркулес. .. Во время голодания следует пить обыкновенную кипяченую воду. Важный момент — выход из голодания. Он по времени длится столько же, сколько вы голодали. Первая трапеза — сырые фрукты или овощи: морковь, репа, редька… Все тщательно и очень долго жевать…

-Но вот эти краткосрочные голодания — полезная для здоровья процедура?
-Думаю, чрезвычайно. Особенно для тех, кто легко набирает вес. Но, разумеется, голодания нужно проводить систематически. Вспомните: религиозные посты — они ведь были и следовали систематически. Отличная профилактика обжорства. Исключив из нашей жизни религию, мы исключили и посты. Но привычку передать мы не исключили. Она осталась.

И вы, скорее всего, не представляете, сколько болезней влечет за собой переедание и вообще неправильное питание… Кстати, вам бы не мешало основательно поголодать. Дней этак 35-40… Николаев окидывает мою фигуру критическим взглядом и продолжает: -Собственно, о краткосрочных голоданиях больше нечего и говорить. Сердитые ваши авторы, вероятно, нарушали даже те немногие существующие правила. .. Отсюда и неприятные ощущения.

Но когда человек к голоданиям привыкает, он ждет голодного дня, как праздника, особенно, если день этот назначается осознанно, если вы представляете и понимаете, зачем вы это делаете. И еще раз, обязательно напоминаю: очень важно правильно войти в голодание и правильно из него выйти, используя молочно-растительную диету. Еще лучше вообще перейти на такую диету…
-То есть стать вегетарианцем?
-Вот-вот — именно так — стать вегетарианцем.
-А Вы — вегетарианец?
-Разумеется.

Вегетарианцами были мои отец и мать. На принципах вегетарианства воспитывалась вся наша семья — мои братья и сестры. Так неожиданно в нашем разговоре с профессором Николаевым возник новый поворот темы. -Да, — говорит он мне, — я вырос в семье, где вегетарианство, если хотите, воспринималась как идеология. Не только как гигиеническое требование, но, возможно, даже прежде как категория нравственная. Люди вообще едят чрезвычайно много. 1300-1400 граммов пищи в день вполне достаточно.

Можно с успехом обходиться — и это абсолютно доказано — и меньшим количеством пищи. Переедание — как алкоголизм: чем больше ешь, тем большая потребность в еде у организма. — Интересно, кем — вегетарианцем или мясоедом — был человек в своем изначале? -Безусловно, вегетарианцем, — решительно отвечает Николаев. — Строение челюстей, зубов, система пищеварения — все свидетельствует о том, что человек на заре существования отдавал предпочтение растительной пище. Мясо вошло в рацион только после того, как Homo sapiens научился извлекать огонь и пользоваться им. Николаев поднимается с кушетки и приглашает меня в гостиную, где все так же очень много книг. На стене два портрета. — Рабиндранат Тагор… А рядом?

— Это Свами Вивокананда, — задумчиво говорит Николаев, — мыслитель и гуманист, ученик Рамакришны, крупнейший представитель йоги.
— Вы знакомы с йогой?
— В какой-то мере да. Но это совсем другая тема. Мне не хотелось бы касаться ее сегодня. Я пригласил вас, чтобы показать фотографии отца и матери. — Отец, — говорит Николаев, — дружил с Львом Николаевичем Толстым.

Юрий Сергеевич достает с полки стопку перевязанных бечевой книг, бережно извлекает тоненькую пожелтевшую от времени книжицу. Читаю на обложке: С.Д.Николаев «Освобождение земли». Предисловие написал Лев Толстой. Я вслушиваюсь в тихий голос Юрия Сергеевича и думаю о его долгой, интересной, но и нелегкой жизни. Уже после революции отец, увлеченный идеями крестьянской экономики, покинет с семьей Москву, купит на Кубани 10 гектаров земли и организует товарищество. Именно в тот период жизни Юрий Сергеевич познает вкус простой крестьянской работы — научится пахать, сеять, сядет на старенький американский трактор «Форзон».

Но случится так, что в 20 лет Юрий Сергеевич тяжело заболеет полиартритом, и, друг семьи врач Николай Григорьевич Судковой вылечит его, применив метод лечебного голодания. Возможно, это исцеление и определило дальнейшую судьбу Николаева: он поступил в 1-й Медицинский институт и в 1932 году его закончил. И будет затем увлечение психиатрией, успешное применение метода лечебного голодания для лечения от некоторых форм шизофрении. Будут единомышленники, будут и враги.

И придется еще продираться через споры, отрицание, непонимание. — Скажите, если я правильно понял, метод лечебного голодания не нов? -Стар, как сам мир, — серьезно говорит Николаев, — но сегодня он защищен и подкреплен основательной научной базой, большой исследовательской работой, нашими знаниями о человеке, хотя — и это тоже надо признать — этих знаний еще крайне недостаточно. — Но имеет ли столь же серьезную научную основу вегетарианство?

В конце концов, никто еще не доказал, что вегетарианцы живут дольше мясоедов и меньше болеют. — Ну уж, не скажите, — парирует Николаев. — Просто вегетарианцев пока очень мало, еще меньше статистики в этой области. Но мои, например, наблюдения убеждают в том, что вегетарианское питание в плане здоровья имеет определенные преимущества.

Кстати, это вовсе не значит, что я навязываю кому-то вегетарианство, хотя убежден — будущий человек будет склонен к вегетарианству в гораздо большей степени, нежели человек сегодняшнего дня. Но в любом случае, особенно в среднем и старшем возрасте, необходимо сокращать потребление животного белка и жира. Нужно меньше есть мяса, рыбы, птицы, сливочного масла, сала и даже яиц. Три раза в неделю, не больше.

И это уже не моя рекомендация — такова позиция подавляющего большинства медиков — специалистов по питанию и развитых странах мира. …Тем, кого интересуют глубинные перемены в организме, сопутствующие голоданию, я бы советовал прочесть книгу профессора, написанную совместно с журналисткой Е.Л.Ниловой «Голодание ради здоровья». Я лично ее прочитал и получил исчерпывающие ответы на многие вопросы. Книгу — последний экземпляр — затертый, хотя и заново переплетенный — дал мне Николаев.

В поисках ее он достал и другую книжицу, на обложке которой значилось: Эптон Синклер.
— Это ведь знаменитый американский писатель?
— Именно, — подтвердил профессор.
— А что общего между ним и голоданием?
— Синклер был страстным поклонником лечебного голодания, содержал специальную клинику и написал о лечебном голодании любопытную книгу.
— Гм.. — тяну я, заинтригованный, — но в чем все-таки заключен оздоровительный эффект голодания?
— Что происходит… пожалуй можно так сказать — радикальная перестройка всего организма. И Николаев принимается рассказывать об этой перестройке. Подробно и точно об этом изложено в книге профессора. Вот выдержки из нее: «При полном голодании, когда больной получает только воду, организм приспосабливается на определенный срок к своему внутреннему питанию, то есть питанию своими запасами жиров, белков, углеводов, витаминов и минеральных солей.
Это питание, оказывается, удовлетворяет все потребности организма и является полноценным. К эндогенному питанию человеческий организм приспосабливается не сразу, на это требуется определенное время, определенная трата энергии. Обычно перестройка происходит на 6-10 день голодания. У биохимиков есть выражение «жиры сгорают в огне углеводов».
В начале голодания, когда в организме еще есть запасы животного сахара — гликогена, жиры сгорают в огне углеводов полностью, но как только запасы гликогена иссякают (а это наступает обычно на первый-второй день голодания), в крови начинают накапливаться кислые продукты неполного сгорания жира (масляные кислоты, ацетон), щелочные резервы ее снижаются, и это отражается на самочувствии больного: у него могут появиться головная боль, тошнота, чувство слабости, общего недомогания.

Такое состояние — результат накопления в крови ядовитых продуктов. Стоит человеку в это время выйти на воздух, глубоко подышать, очистить кишечник с помощью клизмы, принять душ — и все эти симптомы исчезают.

Однако явления легкого самоотравления кислыми продуктами распада жира, выражаясь медицинским языком, — явления ацидотического сдвига, постепенно могут нарастать до 6-10 дня голодания, когда они обычно сразу, в течение короткого времени (иногда одного часа) исчезают, и больной начинает хорошо себя чувствовать. Этот критический период, получивший название «ацидотического криза», возникает в результате приспособления организма к режиму эндогенного питания.

Приспособление это в основном заключается в том, что организм, поставленный в трудные условия, начинает производить сахар из собственного жира и белка, и, при наличии этого сахара жир сгорает полностью. Одновременно с жиром организм должен использовать для своего существования также белки, необходимые для деятельности мозга, сердца, некоторых желез внутренней секреции, крови. .. При лечебном голодании нужные белки черпаются из резервов, имеющихся в тканях менее важных для организма органов.

И тут выяснилась еще одна «тайна» голодания, было сделано важное открытие: во время использования белковых резервов утилизируется прежде всего ослабленная, болезненно измененная ткань, а также имеющиеся в организме опухоли, отеки, спайки и прочее. Этот процесс в медицине называется «аутолиз». При перестройке на эндогенное питание организм для поддержания своего существования расходует и сжигает не только накопленные им резервы, но и шлаки обменного происхождения.

Это один из существенных механизмов лечебного действия голодания. Происходит интенсивное выведение из организма ядовитых продуктов, накопившихся в результате нарушенного обмена, перенесенных заболеваний, длительного приема лекарств, неправильного питания, употребления алкоголя, курения табака и других вредных воздействий, которые могли создать в организме склад болезнетворных ядовитых продуктов».

Можно было бы продолжить цитировать книгу профессора или приводить все новые и новые аспекты беседы с ним. Но чем больше я говорил с Николаевым, тем больше возникало у меня вопросов. Вот как закончилось первое интервью с Юрием Сергеевичем Николаевым. — Вот Вы говорите: надо меньше есть… Но как бороться с аппетитом? — Хочется есть — идите на тренировку, займитесь физическим трудом , пустите в ход аутотренинг . В конце концов, можно «обмануть» чувство голода — съесть сырую морковку или яблоко.

— Как относиться к сахару и соли? — Как к врагам. Если и употреблять соль и сахар, то лучше в связанном варианте — в растениях. Все рекомендации, которые предлагает профессор, испытаны им на себе. Менее всего хотелось бы, чтобы читатели восприняли беседу с Николаевым, как призыв к поголовному и безоглядному голоданию. В разговоре Юрий Сергеевич неоднократно напоминал: 24-36-часовое голодание совершенно безопасно и полезно всем. Что же касается лечебного голодания, то оно должно проходить под наблюдением врача. В крайнем случае, человек, решивший подвергнуть себя подобному испытанию, должен владеть методом, проконсультироваться со специалистом или, наконец, с обладателем подобного опыта. Со времени первого интервью. Прошло лет 8. Весь этот период — первый перестроечный — мы жили, как в лихорадке. Запретное стало возможным.

Появилась масса литературы, которая прежде распространялась лишь в самиздате. Косяком пошли Брэгг, Шелтон, Озава, Ниши и другие авторы. И все это время меня не покидала мысль еще раз поговорить с Юрием Сергеевичем. Может быть произошло какое-то переосмысление? Ведь на момент той первой, далекой уже встречи, ему было 82. Это сколько ж сейчас? Где-то под или даже за 90. Да и жив ли вообще? В записной книжке отыскал номер телефона профессора и звоню. Трубку подняла женщина.

— Можно услышать Юрия Сергеевича? — не без душевного трепета прозвучал сей вопрос, прямо скажу.
— А Юрия Сергеевича нет. (Сердце мое трепыхнулось при этих словах; но произнести слова соболезнования не успел… к счастью. — прим. автора). Он в командировке. Ничего себе…- думаю — в этом-то возрасте… Звоню через пару недель.
— Юрий Сергеевич на работе — ответила та же женщина. — И много работает Юрий Сергеевич?
— Очень много — был ответ. — Когда удобно ему позвонить?
— Вечером.
— Вечер — понятие … (но не успел договорить).
— Не стесняйтесь, звоните — Юрий Сергеевич поздно ложится и рано встает.

По прошествии нескольких дней после звонка и многих лет после первой встречи я все в той же профессорской квартирке на 4-м этаже «хрущевки» по улице Юных ленинцев.
— Вам, Юрий Сергеевич, привет от Михаила Михайловича, — говорю, дабы завязать непринужденную беседу.
— Ему вот-вот исполнится 90…(Имеется в виду М.М.Котляров, ныне тоже покойный. — Прим. автора).
— Мне тоже вот-вот, — роняет как бы между делом Николаев.
Здесь читатели, вероятно, ждут от меня сентенцию в том плане, что Юрию Сергеевичу не дашь 90, что он, дескать, выглядит моложе. Но… я не знаю, как должен выглядеть человек в 90 хотя бы потому, что в России этот возраст — для «Красной книги». Передо мной сухощавый, чуть согбенный человек с выразительным лицом и пристальным, изучающим взглядом живых глаз. Твердая походка, руки едва подрагивают.

На столе старенькая пишущая машинка, в каретку которой вложен лист бумаги, наполовину уже исписанный. Любое предложение помочь встречает в штыки: «Да что вы в самом-то деле — я сам». — Скажите, Вы по-прежнему исповедуете голодание? — Конечно. Но голодаю по необходимости. Тут вот 16 июня надо было лететь в Улан-Удэ — пригласили прочитать цикл лекций. Билет уже взят, а я приболел — насморк, температура, перебои в сердце. Родные и знакомые отговаривали:
«Ну куда в таком состоянии, да еще чуть ли не на край света». Два дня пришлось поголодать… А вот в январе 90-го голодал ровно месяц. Проклюнулись вдруг все старые болячки. Стало совсем худо: передвигался, держась за стул, почти отказала правая рука. Сейчас, видите, все в порядке. — И Вы по-прежнему вегетарианец? — Разумеется. Я уверен, что вегетарианство — лучший способ питания, и, если хотите, образ жизни, нежели все остальные.

Я, поверьте, испытываю отвращение к любой мясной пище — знаю, что она в себе несет. Верю, что идеи вегетарианства в конце концов восторжествуют. — В вестнике «ЗОЖ» мы сейчас публикуем работу Герберта Шелтона «Голодание спасет вашу жизнь». Как Вы относитесь к Шелтону? — Исключительно положительно. Кстати, я сам сейчас закончил книгу о лечебном голодании, переработав издания прошлых лет. Знаете, как она будет называться?.. «Голод не тетка, а мать родная»…

— Вы прожили очень долгую жизнь, излечили множество больных…
— Тысячи, — уточняет Николаев. — …
— Что-то изменилось в Ваших взглядах на голодание?
— Лишь окрепла убежденность в том, что за методом разгрузочно-диетической терапии большое будущее.
— А настоящее?..
— Настоящее… — Николаев мрачнеет.
— Есть приказ Министерства здравоохранения о распространении метода, выпущена специальная методика с правом за медицинскими учреждениями издавать ее на местах. Но косность этих самых учреждений потрясающа.

Не делается ничего. Есть мои ученики. Кое у кого из них небольшие отделения в больницах. Я руковожу отделением московской клинической больницы на 80 коек. Необходим курс лечебного голодания в медицинских ВУЗах. Врачи должны понимать суть голодания, разбираться во всех тонкостях биохимических процессов, связанных с методом разгрузочно-диетической терапии. У меня же масса фактов: пациент просит врача-терапевта направить его ко мне в клинику. «К Николаеву? — спрашивает терапевт, тараща глаза от ужаса. -Да что вы! Одумайтесь! Ни в коем случае не советую». — Хорошо. Это в России. А в мире? Находят ли сочувствие идеи голодания в мире? Особенно в процветающих странах, где изобилие продуктов и изощренных деликатесов? — О, в мире идеи голодания укрепляют свои позиции. Растет число специализированных клиник, множатся ряды врачей-специалистов по лечебному голоданию…

Вы понимаете: голодание, если оно проводится грамотно, абсолютно безвредный метод лечения и прекрасный способ профилактики болезней, а значит продления жизни… активной жизни, замечу. — Юрий Сергеевич, но как Вы пришли к лечению с помощью голодания? Ведь в ту пору, когда Вы начали практиковать, Герберт Шелтон был запрещен, а вместе с ним и вся натуральная медицина находилась в опале. — В какой-то степени все произошло случайно. Я ведь по образованию врач-психиатр. Работал в психиатрической больнице.

Был там ассистентом, наблюдал за больными шизофренией. В одну из моих задач входило кормление больных, впавших с состояние так называемого ступора. Это, знаете ли, что-то вроде приступа. Он мог длиться несколько дней. Ужасное состояние. Все мышцы сведены, зубы сжаты. Человек без сознания. Его приходилось кормить через нос. Вводить специальный зонд в желудок. И однажды подумалось: а что, если не кормить? Я ведь сам голодаю. И ничего со мной не происходит.

В ту пору я уже знал и об ацидозном кризе, и об эндогенном питании, на которое переходит в конце концов организм. Вы понимаете, на самом деле человек и не голодает вовсе. Он полноценно питается. За счет ресурсов собственного организма. Этот процесс и называется эндогенным питанием. Когда ресурсы кончаются, а это может произойти через 3,4,5 недель — у каждого человека по-разному — лицо розовеет и у него появляется аппетит. Это и есть сигнал к окончанию лечебного голодания.

— Так вот, — продолжает профессор, — я решил рискнуть и одного из таких больных в состоянии ступора не кормил. На тумбочке у него стояли фрукты, какая-то простая пища, и произошла сенсация: на 7-й день ночью этот больной самостоятельно встал с постели и съел все то, что было на тумбочке. Этот случай получил широкую огласку в медицинской среде и стал известен за рубежом. А я же получил возможность для дальнейших экспериментов.

Сыграло роль и то обстоятельство, что в клинике в отделении для алкоголиков лежал сын известного партийного деятеля Николая Булганина — Леонид. Он был безнадежен. Несколько раз его вытаскивали с того света врачи-реаниматологи. Отец прибегал к разным мерам, в том числе и к полной изоляции, но Леонид всеми правдами и неправдами добывал спиртное. Это было очень страшно. В минуту просветления он обратился ко мне с просьбой помочь. И клянусь Вам, я его вылечил. С помощью голодания.

Впоследствии он окончил Академию Генерального штаба. Работал. Был нормальным и здоровым человеком. Именно его отец — Николай Булганин — в ту пору он был едва ли не первым человеком в государстве — и предоставил мне возможность получить место и лабораторию в Институте психиатрии Академии медицинских наук СССР. Я смог научно обосновать метод разгрузочно-диетической терапии и защитил докторскую диссертацию. — Но речь идет о шизофрении. Вы же, Юрий Сергеевич, сегодня лечите от самых разных болезней…

— Все очень просто. Я очень быстро заметил, что параллельно с шизофренией люди, благодаря голоданию, избавляются от многих соматических заболеваний. Так возникла мысль… Мы сидим в тесной комнатке. Говорим о голодании. О его внедрении в широкую практику. Профессор Николаев очень осторожен в каких-то конкретных рекомендациях. — Все очень индивидуально, — говорит он. — Я понимаю, что люди, решившиеся голодать, не отступят от задуманного, но лучше все же голодать под наблюдением врача или в конце концов опытного человека, хорошо знакомого с лечебным голоданием. И, конечно же, очень важен выход из голодания.

Он должен длиться столько же дней, сколько и само голодание (эту мысль профессор подчеркивает постоянно — прим. автора). — Почему я так осторожен? — говорит Николаев. — Неудачи дискредитируют метод. Тот же Суворин, не получив признания в России, уехал в Югославию, издал там книгу, практиковал. Но произошло несколько неудач. Кажется, даже со смертельным исходом. И Суворина, так как он не имел медицинского образования, судили и даже посадили в тюрьму.
Там он, кстати, заразил идеями голодания начальника тюрьмы и обратил в свою веру чуть ли не весь персонал. — Но голодание, собственно, одна из отраслей натуропатии. А как Вы относитесь, скажем, к уринотерапии? — Меня часто спрашивают об этом. И на лекциях, и больные. Я отвечаю просто: «Не знаю. Я не применяю». — А «Детка» Порфирия Иванова Вам незнакома? — Не только «Детка» знакома, но и сам Порфирий Иванов.

Когда я работал в Ростове, он не однажды обращался ко мне за справочками на предмет того, что он — нормальный человек. Я давал… Когда мне кто-то говорит о том, что он придерживается заповедей «Детки», я всегда отвечаю: «Придерживайтесь на здоровье, хуже не будет». — Помнится, в прошлую нашу встречу Вы, профессор, говорили о беге. Вы продолжаете занятия? — Конечно. Например, утром я бегал пятнадцать минут. — Бегали? — Ну может быть не в полном смысле этого слова. Сейчас я чередую бег с ходьбой.

Кроме того, я обязательно проделываю зарядку. Вот у меня гантели. Профессор встает, идет в угол комнаты и извлекает из под шкафа гантели, показывает их мне для пущей убедительности. — И еще я обязательно выполняю вот это упражнение. Он хватается руками за металлическую палку, что лежит на двух шкафах, напоминая перекладину, и, чуть-чуть подтягиваясь, резко опускается вниз. — Это для позвоночника, — поясняет профессор. — Еще обязательно выполняю упражнения для брюшного пресса. — А вообще Вам не трудно?

— Что не трудно? — вопрошающе смотрит профессор. — Ну… в… таком… э… возрасте все эти упражнения. ..работа, командировки… э … написание книги… Юрий Сергеевич говорит почти сердито, словно его уличили в чем-то дурном. — Нет, я полон энергии. Мне и-н-т-е-р-е-с-н-о жить. Я работаю. И при чем здесь возраст. — Но ведь другие люди… — Это дело тех самых других людей. Каждый строит свою жизнь, исходя из собственных представлений о ней. Кому-то доставляет удовольствие вкусно поесть.

И это как алкоголь. А для меня высшее удовольствие — возможность побегать, моя работа, общение с друзьями. — Но можем ли мы пропагандировать вегетарианство, если животная пища вкусна, если хороший обед или ужин составляет предмет удовольствия — как говорит один из моих знакомых — выше сексуального. — Вы хотите получить ответы сразу на все ваши вопросы, — говорит Николаев. — А ведь ответы вот здесь. Профессор лезет под подушку и … достает увесистую Библию в кожаном переплете.

— Здесь все написано — и про вегетарианство, и про голодание. А коли все написано, значит это было уже ТОГДА. Просто мы, люди, превратили пищу из хлеба нашего насущного в торжественную процедуру чревоугодничества. — Знаете, профессор, у меня есть знакомый. Он рабочий-металлург. Работает в горячем цехе. Довел свой ежедневный рацион до 1200 ккал. Но он какой-то очень скучный. — У меня тоже есть знакомый. Крупный большой человек, вот вроде вас.

На протяжении многих лет его дневной рацион составляет стакан гречневой крупы, вскипяченной в воде. Этот человек весел, интересен и жизнерадостен. Я ведь не настаиваю на том, чтобы все питались, как этот человек. Но могу заверить вас, что вегетарианская пища может быть вкусна и способна точно так же, как и животная, доставлять удовольствие. Все дело в приоритетах. Мы расстались с профессором Николаевым Юрием Сергеевичем, чтобы встречаться и впредь… Но кто знает, когда прозвенит твой звонок…

Юрия Сергеевича уже нет. Что-то, наверное, осталось недосказанным, недописанным. Его ученики продолжают дело.

Концептуал — 📕ГОЛОДАНИЕ РАДИ ЗДОРОВЬЯ, НИКОЛАЕВ ЮРИЙ…

📚ИСТОРИЯ РОССИИ. КОМПЛЕКТ ИЗ 5 ТОМОВ (ИЗД. ИСПРАВЛЕННОЕ, ДОПОЛНЕННОЕ)

Ищете интересное и понятное издание об истории России? Предлагаем комплект из пяти томов, который содержит не только достоверную информацию, но и карты, портреты, фотографии. Работа историка Евгения Спицына рассказывает о дореволюционном, советском, современном периодах. Надо отметить аргументированность и чёткость изложения материала.

Пятитомник весьма актуален, полезен школьным учителям и преподавателям вузов, читающим лекции по истории России. В повествование вплетено описание большого количества событий, дат, имён. Тем самым издание представляет собой прекрасный путеводитель для читателя и преподавателя, которому предстоит работать по так называемому единому народному учебнику истории. Спицын в какой-то мере пытался скорректировать и нейтрализовать ошибки и просчёты ранее выпущенных книг. Когда он сам работал учителем, а затем и директором в школе Москвы, он обратил внимание на дефицит именно историографической информации в существующих изданиях.

Поэтому Евгений Спицын и взялся за написание такой сложной работы, с чем блестяще справился. Пятитомник уникальный, такие книги в нашей стране раньше не издавались. Всё дело в том, что материал в нём изложен не в привычных схемах и текстовках. Это иллюстрированная история России! На страницах книг представлено больше 90 исторических карт, около 80 аутентичных документов, которых никогда не видели, но многие о них слышали. Наиболее значимым является то, что впервые в одном собрании сосредоточено более 120 редких групповых фотографий из жизни представителей высшей власти нашей страны ХХ в., а также представлены портреты почти 800 деятелей, оставивших в истории заметный след.

Здесь есть изображения всех князей, царей, правителей, а также полководцев и военачальников Советского Союза и императорской России, великих конструкторов, ученых, производственников. Важно и то, что автор ссылается на источники по описываемой теме, помогая сориентироваться в нагромождении научных и околонаучных фактов, гипотез и мнений. Пятитомник Спицына «История России» заинтересует всех любителей подобной литературы, а также будет полезен преподавателям и учащимся, особенно тем, кому предстоит сдавать экзамены по предмету.

↪ ПОКУПАЙТЕ КНИГУ В ИНТЕРНЕТ-МАГАЗИНЕ «КОНЦЕПТУАЛ»
https://konzeptual. ru/spicyn-eju-istorija-rossii-komplekt-iz-5-tomov?utm_source=smi

#Концептуал #урокиистории #ЕвгенийСпицын

Пост для здоровья. Просто информация, а не руководство. — Джон Тристер, доктор медицины

Пост используется для лечения различных хронических состояний, таких как астма, диабет, ожирение, аллергия, аутоиммунные расстройства, а также депрессия и беспокойство. Это особенно полезно при хронических состояниях, невосприимчивых к традиционным методам лечения.

5 этапов длительного водного голодания, используемых в практике др.Юрий Николаев, директор клиники голодания Московского института психиатрии.

Доктор Юрий Николаев лечил более 7000 пациентов с различными заболеваниями с помощью лечебного голодания. Средняя продолжительность голодания — 30 дней.

Доктор Юрий Николаев (1905–1998) впервые столкнулся с практикой голодания в раннем детстве. Когда он или его брат Лев заболевали, их мать лечила их 2-3-дневным постом. Его очень вдохновила книга Аптона Синклера «Лекарство от голодания».Эти двое общались письмами. Эти письма вместе с книгой Синклера окажут глубокое влияние на личный опыт юного Юрия в соблюдении голодания, а также в применении лечебного голодания в его медицинской практике.

Доктор Николаев предупредил, что лечение голода следует проводить только в тщательно контролируемых условиях. Пациент и его родственники должны одобрить процедуру, и перед началом лечения пациент проходит тщательное обследование.

Ограничение питания — отказ от еды — первые 2-3 дня

На этой первой начальной стадии пациенту вводят раствор MgSO4 (сульфат магния, иначе известный как английская соль), чтобы вызвать полное опорожнение кишечника.Горькое послевкусие обычно маскируется глотком сока. Для этого используется лимонная вода.

На начальном этапе пациент очень чувствителен к любому упоминанию о пище — визуальному, обонятельному или даже к простому обсуждению еды. Любое восприятие еды вызывает слюноотделение и может вызвать спазмы желудка. Сон пониженный и поверхностный, пациенты раздражительны, у них может развиться обострение симптомов. Снижение веса составляет от 800 граммов до 1 кг в день, артериальное давление остается стабильным, а сердечный ритм может легко усиливаться и быть нерегулярным.

Фаза ацидоза 3-5 день

Между 3-м и 5-м днями голодания еда больше не стимулирует пациента. Иногда возникают головные боли, головокружение — особенно при пробуждении или переходе из положения сидя в положение стоя. Сообщается также о тошноте и общей слабости.

Язык обычно покрыт белым слоем. Уровень сахара в крови может снизиться до 65% от исходного. Чувство тошноты возникает из-за повышенной кислотности крови. На самом деле, когда организм приспосабливается к недостатку пищи, он начинает сжигать собственный жир, а неполное окисление может привести к образованию продуктов, повышающих кислотность.

Протокол требует увеличения потребления воды, а также физических упражнений — 3 часа в день.

Этот активный распорядок помогает организму дышать и потеть. Это задействует органы выделения для выведения токсинов из организма (кожа, почки, кишечник, печень). Для этого также используются ежедневные колонии. На этом этапе начался кетоз. Ваше тело использует запасы жира для получения энергии.

Сжигание жира имеет несколько преимуществ для вашего здоровья, первая из которых — снижение веса. Кетоз — это предсказуемый способ избавиться от жировых отложений, которые в противном случае остаются нетронутыми даже при здоровом образе жизни.Кроме того, избавление от лишнего жира оказывает на организм детоксикационный эффект. Естественная защита вашего тела использует жировые отложения для хранения токсичных металлов и других токсинов, чтобы они не могли нанести вред вашему организму. Однако во время кетоза эти токсичные металлы и токсины безопасно выводятся из вашего тела по мере истощения жировых запасов. Этот очищающий эффект может временно изменить цвет лица некоторых людей или вызвать другие признаки кризиса заживления.

День компенсации и баланса 4-7

В течение 4-7 дней тело внезапно восстанавливает равновесие, и общее состояние пациента радикально меняется.Ощущение, что ушли, пациенты чувствуют себя сильными, мотивированными, со значительным улучшением настроения. После десятого дня потеря веса стабилизируется на уровне 200 г / день, белый налет на языке очищается, и язык приобретает розоватый цвет.

На третьем этапе ваше тело начинает переходить в «режим исцеления». Этот процесс заживления начинается, когда ваша пищеварительная система отдыхает от ежедневных токсинов. Следовательно, количество свободных радикалов уменьшается, а окислительный стресс уменьшается.

Пост вызывает своего рода «психологический стресс», который приносит пользу для здоровья.Это своего рода легкий стресс, который сравним со стрессом, вызванным дисциплиной в упражнениях, что в конечном итоге делает вас сильнее, а вашу иммунную систему — более устойчивой.

Когда кумулятивные эффекты этого этапа складываются, они могут стать катализатором значительного улучшения здоровья. Ограничение свободных радикалов и окислительного стресса — краеугольный камень здорового старения. Этот процесс исцеления, кажется, улучшает здоровье некоторых.

Еще одно огромное преимущество — это достижение личных целей и рост.Заходя так далеко, преимущества становятся личными и чрезвычайно расширяют возможности. Пост, особенно после первых семи дней, требует огромной самоотдачи. То, что вы получите от поста на этих более поздних этапах, может стать кульминацией всех более ранних этапов, а также выполнением личной задачи.

Прерывание поста — возвращение продуктов питания

Как только пациент преодолевает кризы и испытывает чувство эйфории. Симптомы начинают исчезать, пока не будет израсходован накопленный источник энергии.Это происходит примерно через 30 дней. К этому времени язык у пациента чистый, кожа здорового розового цвета, исчезает неприятный запах изо рта.

Продовольствие возвращается постепенно. Сначала используются разбавленные фруктовые соки, затем цельные соки и тертые фрукты, смешанные с йогуртом. Далее следуют вареные овощи и отварные каши. Ближе к 40-му дню возобновляется нормальное питание. Врач сказал, что лечение голода дает отдых всей нервной системе и мозгу. Организм очищается от ядов, восстанавливаются ткани и железы.

Нормальное питание (еда)

С четвертого по шестой день после прекращения голодания у пациента может значительно повыситься аппетит. Это когда по его просьбе ему могут дать больше фруктов, хлеба и много овощей.

Если лечение голоданием прошло успешно, патологические расстройства пациента улучшатся. Их кровяное давление и уровень глюкозы стабилизируются на исходных значениях. Повышенный аппетит и повышенное настроение обычно сохраняются в течение 2-3 недель, после чего они возвращаются к норме.

(доктор Николаев был вегетарианцем, поэтому он рекомендовал низкое потребление мяса). Есть также много разновидностей этих постов.

В заключение, лечебное голодание может быть очень мощным инструментом для оптимизации самочувствия, его следует применять с максимальной осторожностью и под наблюдением врача. Перед тем, как приступить к этому или любому посту / диете, обсудите с врачом возможные варианты.

Films Media Group — Наука поста

Болезни цивилизации (02:02)
БЕСПЛАТНЫЙ ПРОСМОТР

Ожидаемая продолжительность жизни в западных странах растет, но такие болезни, как диабет, гипертония и рак, стремительно набирают обороты вместе с потреблением лекарств, вызывающих побочные эффекты.Пост восхваляется религиями, но часто игнорируется наукой.

Горящинский родниковый санаторий (02:23)

Эксперимент проходит в самом сердце России, на Сибирских равнинах. За последние 15 лет голодание стало центральной частью политики общественного здравоохранения. Он основан на 40-летних научных исследованиях, неизвестных на Западе. Лечится астма и аллергия.

Программа голодания (02:12)

Голодание — универсальный метод, который может быть эффективным при нескольких заболеваниях.Под наблюдением врача пациенты пьют только воду и прекращают прием лекарств при хронических заболеваниях. Вовлеченность профессионала имеет фундаментальное значение.

Кризис ацидоза (02:26)

10 000 пациентов соблюдали программы голодания в санатории «Горячинский источник», обращаясь за лечением от астмы, ревматизма, диабета, гипертиреоза и аллергии. После детоксикации организм должен научиться жить за счет своих резервов.

Кетоновые тела (02:11)

Глюкоза, жиры и белки являются топливом для организма. После дня голодания организм должен вырабатывать глюкозу из белка. Для улучшения функции органов назначают упражнения, обертывания, сауны и орошение толстой кишки.

Психологический голод (01:05)

Когда организм приспосабливается к голоданию, голова не всегда следует.Пациенты заметили, что психика влияет на тело и может заставить его чувствовать потребности, которых у него больше нет. Когда утихает голод, наступает чувство эйфории.

Опыты в голодании. (02:30)

Является ли уменьшение симптомов голодания у пациентов эффектом плацебо или эффектом эйфории? 60 лет назад исследования проводились в секретных лабораториях Советского Союза. Доктор Юрий Николаев заметил преимущества голодания у пациента, который отказывался от еды.

Научная история (02:19)

Сын доктора Юрия Николаева помнит резкое сопротивление исследованиям его отца со стороны медицинского сообщества. Николаев предпринял обширную исследовательскую программу, чтобы заставить критиков замолчать. Психиатры отметили, что голодание влияет на психические заболевания.

Объяснение эффектов голодания (03:06)

Николаев заметил, что физическое недомогание улучшается после голодания.Исследователи подтвердили результаты. Стресс — это адаптированная реакция на изменение окружающей среды. Столкнувшись с голодом, организм вызывает тревогу, которая вызывает гормональные и эндокринные изменения.

Доказательства способности к исцелению (03:09)

Исследования показали, что голодание устраняет гистамины, которые вызывают спазмы бронхов. Фармацевтические компании на западе не интересуются опубликованными данными, используемыми для установления поста как части политики общественного здравоохранения в Советском Союзе.

Пост для здоровья печени (02:01)

Пост проводится в группе в центре в Германии. Пациенты посещают клинику Бухингера, чтобы избавиться от хронических заболеваний, а также для предотвращения и контроля таких факторов риска, как гипертония, диабет и ожирение.

Клиника Бухингера в Германии (02:39)

Низкокалорийные супы смягчают процесс ацидоза.Резкое выздоровление от ревматической лихорадки побудило основателя клиники изучить терапевтические возможности голодания. Пациентка объясняет, как ей удалось прекратить прием лекарств от ревматизма.

Еда после голодания (01:51)

В зависимости от тяжести заболевания и того, как долго оно было установлено, прекращение приема лекарств не всегда возможно. Пациент, страдающий тяжелым артритом, пытается уменьшить дозу через голодание.

Метод Бухингера в государственных больницах (04:34)

Есть прибыльный рынок для лечения хронических заболеваний. Сделать голодание центром рынка здравоохранения и сократить прибыль фармацевтических компаний еще очень далеко. Благодаря исследованиям ситуация в Германии начинает меняться.

Механизм голодания у животных (03:22)

Императорские пингвины практикуют спонтанный пост.Исследования показывают, что на втором этапе голодания организм резервирует белки и использует жиры для получения энергии. Тело крыс функционирует аналогичным образом.

Пережившие периоды голода (01:53)

Исследования показывают, что в среднем здоровый человек может голодать 40 дней. Способность голодать, должно быть, была механизмом выживания, сформированным историей эволюции.

Преимущества экстремального ограничения калорийности (03:55)

Итальянский исследователь из Университета Южной Калифорнии, изучающий геронтологию, стремится отсрочить хронические заболевания, такие как болезнь Альцгеймера и рак.Его исследование показало, что голодные мыши, которым вводили химиотерапию, имели больше шансов выжить, чем мыши с нормальной диетой.

Ранняя стадия испытания на голодание (03:16)

Интенсивное освещение в СМИ последовало после публикации статей, показывающих, что мышей натощак защищают от побочных эффектов химиотерапии. К открытию очень серьезно отнеслись в онкологической больнице Норриса в Лос-Анджелесе.

Результаты исследования больницы Норриса (02:41)

Судья из Лос-Анджелеса рассказывает ее историю и встречает ученых, которые дали ей надежду после того, как ей поставили диагноз рака груди. Она чувствовала себя более здоровой и испытывала меньше побочных эффектов, когда голодала перед сеансом химиотерапии.

Режим защиты клеток и химиотерапия (03:03)

Пост изменяет функцию клеток. После двух дней голодания гены раковой клетки экспрессируются противоположным образом, чем гены здоровой клетки. Раковые клетки мутировали и больше не обладают эволюционной защитой.

Наука поста: эпилог (02:45)

Исследования, начатые Николаевым, продолжаются, но голодание для многих россиян обходится слишком дорого. Он по-прежнему доступен в санатории «Горящинский источник». Готов ли мир переосмыслить систему здравоохранения и снизить прибыль фармацевтических компаний?

Кредиты: Наука поста (00:48)

Кредиты: Наука поста

Чтобы узнать о дополнительных возможностях аренды и покупки цифровых материалов, обратитесь к консультанту по СМИ по телефону 800-257-5126
(нажмите вариант 3) или в sales @ movies. com.

Профессорский курс голодания — Ayur Medica

Приезд признанного мастера голодания, профессора Станислава Муравьева вызвал настоящий переполох в сообществе специалистов, занимающихся оздоровлением с помощью правильного питания.

Образовательный тур врача из Тюмени включал двухнедельное практическое занятие для врачей Республики Татарстан на Байкале в отделении аюрмедики Центра восточной медицины и двухдневный обучающий семинар для врачей по диете и применению голодание и диетотерапия.Муравьев поделился 30-летним практическим опытом лечения тяжелых заболеваний лечебным голоданием.


Пациенты Центра восточной медицины, которым посчастливилось умереть от голода под его руководством, запомнят оздоровительные поездки с врачом по берегу замерзающего Байкала. Именно в таком виде во время активной прогулки профессор делилась знаниями о правильном питании и образе жизни.
«Вы живете и работаете в уникальном месте: энергия Байкала, сосновый бор, дающий свежайший воздух, — все это так притягательно! Сейчас в Центре восточной медицины «Аюрмедика» проходят курс иностранные пациенты, одна из которых голодала в одной из лучших клиник Европы, и я полностью согласен с их отзывом о том, что полноценное голодание на Байкале лучше, чем в Швейцарии! », — отметил Станислав Анатольевич.

Ученый отметил, что Бурятия отличается от всех регионов страны тем, что здесь долгое время успешно работают несколько клиник по методике Ю. Николаев.

Врачи Бурятии отметили высокий уровень организации мероприятий и исследовательский подход профессора к теме поста: «Получать знания напрямую от наставника — всегда большая ценность! И, конечно же, то, что профессор берет о самых сложных пациентах — свидетельство большого опыта в сложной теме лечебного голодания », — поделились врачи Бурятии по итогам семинаров, кстати, они получили сертификаты и сертификаты.

Лечебное голодание — стаж врача Николаева

Жанр: научно-популярный
Продолжительность: 00:05:25

Редкие кадры о лечебном голодании в СССР. Интервью взято у профессора Николаева Ю. С., который сначала испытал лечебное голодание на практике на себе, а затем и на своих пациентах. Эту диету профессор позаимствовал у йогов.

— На основании своего опыта могу с уверенностью сказать, что йога совершенно справедливо настаивает на умеренности в питании, и что следует отдавать предпочтение овощам и фруктам. А спустя 45 лет, как подтверждено моим личным опытом и врачебной практикой, чем меньше мяса — тем дольше жизнь. Иногда полезно, особенно если вы плохо себя чувствуете, полностью отказаться от еды в течение нескольких дней. В этот период организм интенсивно освобождается от вредных шлаков и шлаков (см. Причины скопления шлаков в организме).

Примеры восстановления методом Николаева

На примере двух братьев, страдающих тяжелым ожирением, Dr.Николаев показывает целительную силу голодания. За 3 месяца под наблюдением врачей клиники братьям удалось пройти 5 циклов голодания. За это время пациенты чувствуют себя лучше, их вес уменьшился. А к окончанию 9 курса голодания младший и старший брат похудели на 72 и 88 кг соответственно.

Очередной пациент врача страдал гипертонией, ангиной, бессонницей. После 25-дневного курса голодания у испытуемого упало давление, нормализовалась работа сердца, исчезла бессонница.

Третий больной страдает язвой желудка. После соответствующего курса лечения голоданием он полностью здоров.

Этюды тех времен

Исследования показали, что дозированное голодание может лечить не только ожирение, расстройства нервной и желудочной систем, но также аллергические и сосудистые заболевания. Более того, голодание мобилизует защитные реакции в организме, дарованные нам природой даже в те времена, когда люди не могли постоянно удовлетворять свои потребности в питании.В этом состоянии силы организма направлены на восстановление здоровья и борьбу с множеством заболеваний.

См. Также:

Zamiatin_i-viii_1-377_verstka_2308-2013.indd

% PDF-1.7 % 1126 0 объект >] / PageLabels 1018 0 R / Pages 1021 0 R / StructTreeRoot 1173 0 R / Type / Catalog / ViewerPreferences >>> endobj 1122 0 объект > поток 2013-08-24T00: 44: 44 + 04: 002017-12-12T15: 11: 32-05: 002017-12-12T15: 11: 32-05: 00Adobe InDesign CS5.5 (7.5.3) UUID: dc3a8ccc-c5e1-4088-9cf7-66d0de29d179xmp.did: 51FF992B870BE3119278843516883A9Fxmp.did: 85C804B0B2B2E2119A8D977DEA83F2F0proof: PDF1

  • createdxmp. iid: 85C804B0B2B2E2119A8D977DEA83F2F02013-05-02T01: 58: 50 + 03: 00Adobe InDesign 7.5
  • savedxmp.iid: 89C804B0B2B2E2119A8D977DEA83F2F02013-05-02T02: 09: 28 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8AC804B0B2B2E2119A8D977DEA83F2F02013-05-02T02: 09: 28 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: 13D3A54764B3E211B723C0FEF19estiveC42013-05-02T23: 10: 05 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 14D3A54764B3E211B723C0FEF19 VivoC42013-05-02T23: 14: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 15D3A54764B3E211B723C0FEF19 VivoC42013-05-02T23: 25: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: AB8A343267B3E211B723C0FEF195EV52013-05-02T23: 30: 58 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • сохраненный xmp.iid: 41B3268767B3E211B723C0FEF19estiveC42013-05-02T23: 33: 20 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 49B3268767B3E211B723C0FEF195EV52013-05-03T00: 02: 25 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 6E0C61C66CB3E211B723C0FEF195EV52013-05-03T00: 10: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 1B19B1226DB3E211B723C0FEF19 VVVVC42013-05-03T00: 13: 28 + 03: 00 Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 561C

    EB3E211ABEDC4F4F4283
  • 13-05-03T00: 20: 36 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: DCE45F6B73B3E211ABEDC4F4F4283
  • 13-05-03T00: 58: 27 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: A0ABC5EA74B3E211ABEDC4F4F4283
  • 13-05-03T01: 09: 11 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6EA2B70D76B3E211ABEDC4F4F4283
  • 13-05-03T01: 17: 19 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 321C49B879B3E211ABEDC4F4F4283
  • 13-05-03T01: 43: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 60DAE6497CB3E211ABEDC4F4F4283
  • 13-05-03T02: 01: 57 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1007F3647DB3E211ABEDC4F4F4283
  • 13-05-03T02: 09: 52 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: A0EA34A47EB3E211ABEDC4F4F4283
  • 13-05-03T02: 18: 47 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 56FF23C77EB3E211ABEDC4F4F4283
  • 13-05-03T02: 19: 46 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D87D4A1280B3E211ABEDC4F4F4283
  • 13-05-03T02: 29: 01 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5201D93080B3E211ABEDC4F4F4283
  • 13-05-03T02: 29: 53 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EECB687B80B3E211ABEDC4F4F4283
  • 13-05-03T02: 31: 58 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: B7FB5E8680B3E211ABEDC4F4F4283
  • 13-05-03T02: 32: 16 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: B8FB5E8680B3E211ABEDC4F4F4283
  • 13-05-03T02: 34: 58 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B9FB5E8680B3E211ABEDC4F4F4283
  • 13-05-03T02: 37: 30 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F0F28F4D81B3E211ABEDC4F4F4283
  • 13-05-03T02: 37: 50 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 4B73711684B3E211ABEDC4F4F4283
  • 13-05-03T02: 57: 46 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E31DC3B384B3E211ABEDC4F4F4283
  • 13-05-03T03: 02: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: E41DC3B384B3E211ABEDC4F4F4283
  • 13-05-03T03: 03: 11 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 1010F4D784B3E211ABEDC4F4F4283
  • 13-05-03T03: 03: 11 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 1310F4D784B3E211ABEDC4F4F4283
  • 13-05-03T03: 10: 48 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1410F4D784B3E211ABEDC4F4F4283
  • 13-05-03T03: 11: 16 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: 1510F4D784B3E211ABEDC4F4F4283
  • 13-05-03T03: 13: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1610F4D784B3E211ABEDC4F4F4283
  • 13-05-03T03: 15: 49 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • сохраненный xmp.iid: 08C5E8B286B3E211ABEDC4F4F4283
  • 13-05-03T03: 16: 28 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 09C5E8B286B3E211ABEDC4F4F4283
  • 13-05-03T03: 19: 49 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0AC5E8B286B3E211ABEDC4F4F4283
  • 13-05-03T03: 19: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0BC5E8B286B3E211ABEDC4F4F4283
  • 13-05-03T03: 20: 28 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 10C5E8B286B3E211ABEDC4F4F4283
  • 13-05-03T03: 23: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 70F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 24: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 71F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 24: 45 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 72F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 26 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 73F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 26: 31 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 74F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 26: 31 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 79F778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 37: 51 + 03: 00Adobe InDesign 7. 5 / метаданные
  • Savedxmp.iid: 7AF778CD87B3E211ABEDC4F4F4283
  • 13-05-03T03: 37: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: C83129CA89B3E211ABEDC4F4F4283
  • 13-05-03T03: 38: 35 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: C93129CA89B3E211ABEDC4F4F4283
  • 13-05-03T03: 38: 35 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: CA3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T03: 45: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: CB3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T03: 48: 08 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp. iid: CC3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T03: 49: 41 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: CD3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 09: 17 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savexmp.iid: CE3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 09: 46 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: CF3129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 22: 15 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: D03129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 22: 15 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D13129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 31: 14 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: D23129CA89B3E211ABEDC4F4F4283
  • 13-05-03T04: 33: 51 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 586B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 33: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 596B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 34: 34 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5A6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 35: 20 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5B6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 39: 17 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 5C6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 40: 30 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 5D6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 40: 45 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5E6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 46: 36 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5F6B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 48: 21 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 606B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T04: 48: 42 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 616B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T05: 01: 59 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 626B6D8291B3E211ABEDC4F4F4283
  • 13-05-03T05: 06: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 56A86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 14: 30 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 57A86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 20: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 58A86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 22: 05 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 59A86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 28: 21 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp. iid: 5AA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 32: 07 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 5BA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 32: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 5CA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 41: 49 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5DA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 42: 54 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 5EA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 42: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5FA86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 43: 32 + 03: 00Adobe InDesign 7. 5 / метаданные
  • сохраненный xmp.iid: 60A86F3097B3E211ABEDC4F4F4283
  • 13-05-03T05: 43: 32 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 39847CC308B7E2119642FF7B737908D32013-05-07T14: 25: 04 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 3A847CC308B7E2119642FF7B737908D32013-05-07T14: 25: 04 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 3B847CC308B7E2119642FF7B737908D32013-05-07T14: 31: 34 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 3C847CC308B7E2119642FF7B737908D32013-05-07T14: 55: 03 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 3E847CC308B7E2119642FF7B737908D32013-05-07T14: 55: 03 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 40847CC308B7E2119642FF7B737908D32013-05-07T14: 58: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B1735BD258B7E211BBB39C36FC20B1AF2013-05-07T23: 58: 08 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: B3735BD258B7E211BBB39C36FC20B1AF2013-05-07T23: 58: 08 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B5735BD258B7E211BBB39C36FC20B1AF2013-05-08T00: 00 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B7735BD258B7E211BBB39C36FC20B1AF2013-05-08T00: 04: 12 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B9735BD258B7E211BBB39C36FC20B1AF2013-05-08T00: 13: 11 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp. iid: F8A448BE5BB7E211BBB39C36FC20B1AF2013-05-08T00: 19: 03 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FAA448BE5BB7E211BBB39C36FC20B1AF2013-05-08T00: 34: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FCA448BE5BB7E211BBB39C36FC20B1AF2013-05-08T00: 49: 06 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FDA448BE5BB7E211BBB39C36FC20B1AF2013-05-08T01: 09: 55 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: FFA448BE5BB7E211BBB39C36FC20B1AF2013-05-08T01: 09: 55 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 01A548BE5BB7E211BBB39C36FC20B1AF2013-05-08T01: 15: 29 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0CE3893C68B7E211BBB39C36FC20B1AF2013-05-08T01: 48: 29 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 0EE3893C68B7E211BBB39C36FC20B1AF2013-05-08T01: 55: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 10E3893C68B7E211BBB39C36FC20B1AF2013-05-08T01: 59: 03 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 12E3893C68B7E211BBB39C36FC20B1AF2013-05-08T02: 02: 43 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 14E3893C68B7E211BBB39C36FC20B1AF2013-05-08T02: 19: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 16E3893C68B7E211BBB39C36FC20B1AF2013-05-08T02: 37: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: CDD8296A76B7E211BBB39C36FC20B1AF2013-05-08T03: 29: 58 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: CFD8296A76B7E211BBB39C36FC20B1AF2013-05-08T03: 45: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D1D8296A76B7E211BBB39C36FC20B1AF2013-05-08T04: 17: 43 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D3D8296A76B7E211BBB39C36FC20B1AF2013-05-08T04: 20: 53 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: D5D8296A76B7E211BBB39C36FC20B1AF2013-05-08T04: 21: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B40EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 22: 44 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B60EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 24: 03 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B80EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 27: 08 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • сохраненный xmp.iid: BA0EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 30: 12 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BB0EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 41: 07 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: BD0EB0C87DB7E211BBB39C36FC20B1AF2013-05-08T04: 41: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 58B9682781B7E211BBB39C36FC20B1AF2013-05-08T04: 46: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: D75B66880FB9E211939ABD5075BAC5662013-05-10T04: 18: 33 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: D95B66880FB9E211939ABD5075BAC5662013-05-10T04: 18: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: DB5B66880FB9E211939ABD5075BAC5662013-05-10T04: 35: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: DD5B66880FB9E211939ABD5075BAC5662013-05-10T04: 44: 05 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: DE5B66880FB9E211939ABD5075BAC5662013-05-10T05: 02: 39 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: E05B66880FB9E211939ABD5075BAC5662013-05-10T05: 02: 39 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F9BA
  • EB9E211939ABD5075BAC5662013-05-10T06: 06: 11 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FABA
  • EB9E211939ABD5075BAC5662013-05-10T06: 06: 34 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: FCBA
  • EB9E211939ABD5075BAC5662013-05-10T06: 06: 34 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: FDBA
  • EB9E211939ABD5075BAC5662013-05-10T06: 13: 35 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FFBA
  • EB9E211939ABD5075BAC5662013-05-10T06: 14: 53 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8ADEDE8398B9E211A6B6FD7808D89F452013-05-10T20: 39: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 8BDEDE8398B9E211A6B6FD7808D89F452013-05-10T20: 51: 14 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 8DDEDE8398B9E211A6B6FD7808D89F452013-05-10T20: 51: 14 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8FDEDE8398B9E211A6B6FD7808D89F452013-05-10T20: 52: 42 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 92DEDE8398B9E211A6B6FD7808D89F452013-05-10T21: 00: 17 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 962877199CB9E211A6B6FD7808D89F452013-05-10T21: 04: 46 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 992877199CB9E211A6B6FD7808D89F452013-05-10T21: 26: 17 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9C2877199CB9E211A6B6FD7808D89F452013-05-10T21: 33: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9D2877199CB9E211A6B6FD7808D89F452013-05-10T21: 56: 41 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: 89E9DE59A3B9E211A6B6FD7808D89F452013-05-10T21: 56: 41 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8CE9DE59A3B9E211A6B6FD7808D89F452013-05-10T21: 58: 36 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 8FE9DE59A3B9E211A6B6FD7808D89F452013-05-10T21: 59: 06 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 92E9DE59A3B9E211A6B6FD7808D89F452013-05-10T22: 21: 27 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: DE739709ADB9E211A6B6FD7808D89F452013-05-10T23: 06: 01 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 53DBE8DB91BAE211BB2B80EEA34968132013-05-12T02: 23: 59 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 57DBE8DB91BAE211BB2B80EEA34968132013-05-12T02: 23: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5BDBE8DB91BAE211BB2B80EEA34968132013-05-12T03: 03: 48 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp. iid: 1386C47A98BAE211BB2B80EEA34968132013-05-12T03: 11: 23 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1686C47A98BAE211BB2B80EEA34968132013-05-12T03: 15: 16 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1986C47A98BAE211BB2B80EEA34968132013-05-12T03: 30: 08 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1C86C47A98BAE211BB2B80EEA34968132013-05-12T03: 31: 54 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: E23C843C9CBAE211BB2B80EEA34968132013-05-12T03: 38: 16 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E83C843C9CBAE211BB2B80EEA34968132013-05-12T03: 52: 01 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B89E46C59EBAE211BB2B80EEA34968132013-05-12T03: 56: 25 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: B99E46C59EBAE211BB2B80EEA34968132013-05-12T03: 58: 13 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: BC9E46C59EBAE211BB2B80EEA34968132013-05-12T03: 58: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BD9E46C59EBAE211BB2B80EEA34968132013-05-12T04: 00: 07 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: C09E46C59EBAE211BB2B80EEA34968132013-05-12T04: 00: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4B0394D3C2BCE2118B7AB39BBCF7457D2013-05-14T21: 19: 33 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: 4E0394D3C2BCE2118B7AB39BBCF7457D2013-05-14T21: 19: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 4F0394D3C2BCE2118B7AB39BBCF7457D2013-05-14T21: 44: 45 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 520394D3C2BCE2118B7AB39BBCF7457D2013-05-14T21: 59: 56 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F0ECADC4C8BCE2118B7AB39BBCF7457D2013-05-14T22: 02: 05 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: F3ECADC4C8BCE2118B7AB39BBCF7457D2013-05-14T22: 13: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 851EEAE715D2E21184A6F450E5DF168B2013-06-11T00: 37: 10 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 881EEAE715D2E21184A6F450E5DF168B2013-06-11T00: 37: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 891EEAE715D2E21184A6F450E5DF168B2013-06-11T00: 40: 18 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • сохраненный xmp.iid: 8C1EEAE715D2E21184A6F450E5DF168B2013-06-11T00: 42: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 207FE60117D2E21184A6F450E5DF168B2013-06-11T00: 45: 03 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 237FE60117D2E21184A6F450E5DF168B2013-06-11T00: 45: 31 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 267FE60117D2E21184A6F450E5DF168B2013-06-11T00: 46: 14 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 297FE60117D2E21184A6F450E5DF168B2013-06-11T00: 57: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D9AFBE0C19D2E21184A6F450E5DF168B2013-06-11T00: 59: 40 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: DCAFBE0C19D2E21184A6F450E5DF168B2013-06-11T01: 03: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: DFAFBE0C19D2E21184A6F450E5DF168B2013-06-11T01: 23: 48 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: E2AFBE0C19D2E21184A6F450E5DF168B2013-06-11T01: 26: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 44E709761DD2E21184A6F450E5DF168B2013-06-11T01: 31: 15 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 47E709761DD2E21184A6F450E5DF168B2013-06-11T01: 32: 12 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4AE709761DD2E21184A6F450E5DF168B2013-06-11T01: 33: 57 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 7CB63DF71DD2E21184A6F450E5DF168B2013-06-11T01: 34: 51 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 7FB63DF71DD2E21184A6F450E5DF168B2013-06-11T01: 36: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 82B63DF71DD2E21184A6F450E5DF168B2013-06-11T01: 38: 12 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 85B63DF71DD2E21184A6F450E5DF168B2013-06-11T01: 38: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 65B0D8921ED2E21184A6F450E5DF168B2013-06-11T01: 39: 12 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 68B0D8921ED2E21184A6F450E5DF168B2013-06-11T01: 57: 06 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6BB0D8921ED2E21184A6F450E5DF168B2013-06-11T01: 59: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 6EB0D8921ED2E21184A6F450E5DF168B2013-06-11T02: 01: 04 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 78A0FEBC21D2E21184A6F450E5DF168B2013-06-11T02: 01: 52 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7BA0FEBC21D2E21184A6F450E5DF168B2013-06-11T02: 02: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7EA0FEBC21D2E21184A6F450E5DF168B2013-06-11T02: 06: 36 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: AA64D78B22D2E21184A6F450E5DF168B2013-06-11T02: 07: 39 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: AD64D78B22D2E21184A6F450E5DF168B2013-06-11T02: 12: 28 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B064D78B22D2E21184A6F450E5DF168B2013-06-11T02: 12: 49 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: B364D78B22D2E21184A6F450E5DF168B2013-06-11T02: 13: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4D27D56E23D2E21184A6F450E5DF168B2013-06-11T02: 13: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 5027D56E23D2E21184A6F450E5DF168B2013-06-11T02: 14: 20 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5327D56E23D2E21184A6F450E5DF168B2013-06-11T02: 14: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5627D56E23D2E21184A6F450E5DF168B2013-06-11T02: 15: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B88F0BC523D2E21184A6F450E5DF168B2013-06-11T02: 16: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp. iid: BB8F0BC523D2E21184A6F450E5DF168B2013-06-11T02: 17: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BE8F0BC523D2E21184A6F450E5DF168B2013-06-11T02: 18: 15 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0CFF001924D2E21184A6F450E5DF168B2013-06-11T02: 18: 45 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0FFF001924D2E21184A6F450E5DF168B2013-06-11T02: 19: 25 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 12FF001924D2E21184A6F450E5DF168B2013-06-11T02: 19: 50 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 15FF001924D2E21184A6F450E5DF168B2013-06-11T02: 20: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0996435C24D2E21184A6F450E5DF168B2013-06-11T02: 20: 38 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 0C96435C24D2E21184A6F450E5DF168B2013-06-11T02: 21: 34 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 0F96435C24D2E21184A6F450E5DF168B2013-06-11T02: 21: 47 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1296435C24D2E21184A6F450E5DF168B2013-06-11T02: 23: 43 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 94D3CAD524D2E21184A6F450E5DF168B2013-06-11T02: 24: 02 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 97D3CAD524D2E21184A6F450E5DF168B2013-06-11T02: 24: 21 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 9AD3CAD524D2E21184A6F450E5DF168B2013-06-11T02: 24: 49 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 8803190C25D2E21184A6F450E5DF168B2013-06-11T02: 25: 33 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8B03190C25D2E21184A6F450E5DF168B2013-06-11T02: 26: 19 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8E03190C25D2E21184A6F450E5DF168B2013-06-11T02: 26: 48 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid:
  • 90C25D2E21184A6F450E5DF168B2013-06-11T02: 27: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 73D5B66125D2E21184A6F450E5DF168B2013-06-11T02: 27: 56 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 76D5B66125D2E21184A6F450E5DF168B2013-06-11T02: 28: 32 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 79D5B66125D2E21184A6F450E5DF168B2013-06-11T02: 29: 14 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • сохраненный xmp.iid: 7CD5B66125D2E21184A6F450E5DF168B2013-06-11T02: 30: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C6CA0B0626D2E21184A6F450E5DF168B2013-06-11T02: 32: 32 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C9CA0B0626D2E21184A6F450E5DF168B2013-06-11T02: 33: 35 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: CCCA0B0626D2E21184A6F450E5DF168B2013-06-11T02: 35: 01 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 147E9D8E26D2E21184A6F450E5DF168B2013-06-11T02: 36: 21 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 177E9D8E26D2E21184A6F450E5DF168B2013-06-11T02: 36: 56 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 1A7E9D8E26D2E21184A6F450E5DF168B2013-06-11T02: 37: 51 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1D7E9D8E26D2E21184A6F450E5DF168B2013-06-11T02: 40: 30 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 4700B34127D2E21184A6F450E5DF168B2013-06-11T02: 41: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4A00B34127D2E21184A6F450E5DF168B2013-06-11T02: 41: 50 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4D00B34127D2E21184A6F450E5DF168B2013-06-11T02: 42: 52 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5000B34127D2E21184A6F450E5DF168B2013-06-11T02: 53: 48 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: B405EEAB29D2E21184A6F450E5DF168B2013-06-11T02: 58: 39 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: B705EEAB29D2E21184A6F450E5DF168B2013-06-11T03: 05: 14 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B805EEAB29D2E21184A6F450E5DF168B2013-06-11T03: 05: 24 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: BB05EEAB29D2E21184A6F450E5DF168B2013-06-11T03: 05: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: BC05EEAB29D2E21184A6F450E5DF168B2013-06-11T03: 25: 45 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C81E9F312FD2E21184A6F450E5DF168B2013-06-11T03: 38: 11 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: CB1E9F312FD2E21184A6F450E5DF168B2013-06-11T04: 04 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 8BB780F236D2E211B64FE5A3956096452013-06-11T04: 33: 41 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: E176AE346BD2E21186F586C27ADAB1282013-06-11T10: 47: 46 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E476AE346BD2E21186F586C27ADAB1282013-06-11T10: 58: 25 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6B523B0467D3E211A6B7D19E7B9B12342013-06-12T16: 50: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6E523B0467D3E211A6B7D19E7B9B12342013-06-12T16: 51: 52 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 71523B0467D3E211A6B7D19E7B9B12342013-06-12T16: 52: 56 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B1BC1C6F68D3E211A6B7D19E7B9B12342013-06-12T17: 00: 26 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: B4BC1C6F68D3E211A6B7D19E7B9B12342013-06-12T17: 01: 03 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B7BC1C6F68D3E211A6B7D19E7B9B12342013-06-12T17: 12: 26 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: BABC1C6F68D3E211A6B7D19E7B9B12342013-06-12T17: 32: 19 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E8B15CFA6CD3E211A6B7D19E7B9B12342013-06-12T17: 32: 58 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EBB15CFA6CD3E211A6B7D19E7B9B12342013-06-12T17: 47: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EEB15CFA6CD3E211A6B7D19E7B9B12342013-06-12T17: 48: 59 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp. iid: EFB15CFA6CD3E211A6B7D19E7B9B12342013-06-12T17: 57: 22 + 03: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 2D211D6370D3E211A6B7D19E7B9B12342013-06-12T17: 57: 22 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 516FA28D73D3E2118D67B7EDA1C4E1E42013-06-12T18: 20: 02 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7F6D5775DCD4E21199A988D4800EAAA12013-06-14T13: 46: 32 + 03: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: 575586ADDFD4E21199A988D4800EAAA12013-06-14T13: 46: 32 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5A5586ADDFD4E21199A988D4800EAAA12013-06-14T14: 14: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5D5586ADDFD4E21199A988D4800EAAA12013-06-14T14: 14: 58 + 03: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 605586ADDFD4E21199A988D4800EAAA12013-06-14T14: 15: 27 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: F827FBDAE3D4E21199A988D4800EAAA12013-06-14T14: 16: 27 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FB27FBDAE3D4E21199A988D4800EAAA12013-06-14T14: 17: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FE27FBDAE3D4E21199A988D4800EAAA12013-06-14T14: 19: 40 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 50FC6C6CE4D4E21199A988D4800EAAA12013-06-14T14: 20: 31 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 53FC6C6CE4D4E21199A988D4800EAAA12013-06-14T14: 22: 44 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 56FC6C6CE4D4E21199A988D4800EAAA12013-06-14T14: 23: 25 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 59FC6C6CE4D4E21199A988D4800EAAA12013-06-14T14: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 630394FEE4D4E21199A988D4800EAAA12013-06-14T14: 24: 36 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 660394FEE4D4E21199A988D4800EAAA12013-06-14T14: 25: 37 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6
  • FEE4D4E21199A988D4800EAAA12013-06-14T14: 26: 13 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6C0394FEE4D4E21199A988D4800EAAA12013-06-14T14: 27: 10 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: DC510175E5E21199A988D4800EAAA12013-06-14T14: 27: 55 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: DF510175EVD4E21199A988D4800EAAA12013-06-14T14: 28: 18 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: E2510175E5E21199A988D4800EAAA12013-06-14T14: 39: 26 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • Savedxmp.iid: E3510175E5E21199A988D4800EAAA12013-06-14T14: 39: 26 + 03: 00Adobe InDesign 7.5 / метаданные
  • Savedxmp.iid: E4510175E5E21199A988D4800EAAA12013-06-14T14: 45: 07 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • сохраненный xmp.iid: 281C990AE8D4E21199A988D4800EAAA12013-06-14T14: 46: 24 + 03: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BCDB26D863D8E21186FAE57CCF77F7762013-06-19T02: 17: 56 + 04: 00Adobe InDesign 7. 5 / метаданные
  • savedxmp.iid: BFDB26D863D8E21186FAE57CCF77F7762013-06-19T02: 17: 56 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C0DB26D863D8E21186FAE57CCF77F7762013-06-19T02: 21: 30 + 04: 00Adobe InDesign 7.5 / метаданные
  • сохраненный xmp.iid: C1DB26D863D8E21186FAE57CCF77F7762013-06-19T02: 21: 30 + 04: 00Adobe InDesign 7.5 /
  • savedxmp.iid: C2DB26D863D8E21186FAE57CCF77F7762013-06-19T02: 21: 49 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: C3DB26D863D8E21186FAE57CCF77F7762013-06-19T02: 21: 49 + 04: 00Adobe InDesign 7.5 /
  • savedxmp.iid: 215815F866D8E21186FAE57CCF77F7762013-06-19T02: 32: 33 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 225815F866D8E21186FAE57CCF77F7762013-06-19T02: 38: 58 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 235815F866D8E21186FAE57CCF77F7762013-06-19T02: 40: 52 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 245815F866D8E21186FAE57CCF77F7762013-06-19T02: 41: 04 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 255815F866D8E21186FAE57CCF77F7762013-06-19T02: 41: 04 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 265815F866D8E21186FAE57CCF77F7762013-06-19T03: 18: 12 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 275815F866D8E21186FAE57CCF77F7762013-06-19T03: 28: 32 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 285815F866D8E21186FAE57CCF77F7762013-06-19T03: 28: 32 + 04: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 9D72D10B9CD9E211AB2BFF122283E1992013-06-20T15: 26: 32 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 9E72D10B9CD9E211AB2BFF122283E1992013-06-20T15: 26: 32 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9F72D10B9CD9E211AB2BFF122283E1992013-06-20T15: 31: 45 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: A072D10B9CD9E211AB2BFF122283E1992013-06-20T15: 31: 45 + 04: 00Adobe InDesign 7.5 /
  • savedxmp.iid: 81454DDDABD9E2119AD2FA1269

    F2013-06-20T17: 18: 15 + 04: 00Adobe InDesign 7.5 / метаданные

  • savedxmp.iid: 82454DDDABD9E2119AD2FA1269

    F2013-06-20T17: 18: 15 + 04: 00 Adobe InDesign 7.5 /; / метаданные

  • savedxmp. iid: 83454DDDABD9E2119AD2FA1269

    F2013-06-20T17: 28: 51 + 04: 00Adobe InDesign 7.5 /; / метаданные

  • savedxmp.iid: 84454DDDABD9E2119AD2FA1269

    F2013-06-20T17: 37: 07 + 04: 00Adobe InDesign 7.5 /; / метаданные

  • savedxmp.iid: 85454DDDABD9E2119AD2FA1269

    F2013-06-20T18: 16: 11 + 04: 00Adobe InDesign 7.5 / метаданные

  • savedxmp.iid: 86454DDDABD9E2119AD2FA1269

    F2013-06-20T18: 16: 11 + 04: 00 Adobe InDesign 7.5 /; / метаданные

  • savedxmp.iid: 87454DDDABD9E2119AD2FA1269

    F2013-06-20T20: 44: 19 + 04: 00Adobe InDesign 7.5 /; / метаданные

  • savedxmp.iid: 88454DDDABD9E2119AD2FA1269

    F2013-06-20T20: 44: 25 + 04: 00Adobe InDesign 7.5 / метаданные

  • savedxmp.iid: 89454DDDABD9E2119AD2FA1269

    F2013-06-20T20: 44: 25 + 04: 00Adobe InDesign 7. 5 /; / метаданные

  • savedxmp.iid: 8A454DDDABD9E2119AD2FA1269

    F2013-06-20T20: 49: 41 + 04: 00 Adobe InDesign 7.5 /; / метаданные

  • savedxmp.iid: 21210F60D2D9E2118CABA80169BBF7082013-06-20T21: 53: 55 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 22210F60D2D9E2118CABA80169BBF7082013-06-20T21: 53: 55 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 23210F60D2D9E2118CABA80169BBF7082013-06-20T22: 16: 09 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 24210F60D2D9E2118CABA80169BBF7082013-06-20T22: 44: 24 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 25210F60D2D9E2118CABA80169BBF7082013-06-20T22: 45: 03 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 26210F60D2D9E2118CABA80169BBF7082013-06-20T22: 47: 55 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 27210F60D2D9E2118CABA80169BBF7082013-06-20T22: 51: 59 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 28210F60D2D9E2118CABA80169BBF7082013-06-20T23: 18: 39 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 29210F60D2D9E2118CABA80169BBF7082013-06-20T23: 33: 06 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 2A210F60D2D9E2118CABA80169BBF7082013-06-20T23: 33: 06 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6666EF6DE0D9E2118CABA80169BBF7082013-06-20T23: 34: 31 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6766EF6DE0D9E2118CABA80169BBF7082013-06-20T23: 42: 17 + 04: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: 6866EF6DE0D9E2118CABA80169BBF7082013-06-20T23: 45: 24 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6966EF6DE0D9E2118CABA80169BBF7082013-06-21T00: 04: 45 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6A66EF6DE0D9E2118CABA80169BBF7082013-06-21T00: 17: 31 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6B66EF6DE0D9E2118CABA80169BBF7082013-06-21T00: 55: 07 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6C66EF6DE0D9E2118CABA80169BBF7082013-06-21T01: 30: 54 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6D66EF6DE0D9E2118CABA80169BBF7082013-06-21T01: 33: 17 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp. iid: 6E66EF6DE0D9E2118CABA80169BBF7082013-06-21T01: 41: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6F66EF6DE0D9E2118CABA80169BBF7082013-06-21T01: 51: 21 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7066EF6DE0D9E2118CABA80169BBF7082013-06-21T02: 00: 43 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 108870E9F4D9E2118CABA80169BBF7082013-06-21T02: 01: 08 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 118870E9F4D9E2118CABA80169BBF7082013-06-21T02: 12: 15 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BD0AAD1283DAE2118577F36071D057402013-06-21T18: 58: 46 + 04: 00 Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: BE0AAD1283DAE2118577F36071D057402013-06-21T18: 58: 46 + 04: 00Adobe InDesign 7. 5 /; / метаданные
  • savedxmp.iid: BF0AAD1283DAE2118577F36071D057402013-06-21T19: 14: 32 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C00AAD1283DAE2118577F36071D057402013-06-21T19: 24: 55 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C10AAD1283DAE2118577F36071D057402013-06-21T19: 27: 24 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C20AAD1283DAE2118577F36071D057402013-06-21T20: 29: 36 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: ED661E7D5BDBE211958FE217859266C12013-06-22T20: 47: 56 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: EE661E7D5BDBE211958FE217859266C12013-06-22T20: 47: 56 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EF661E7D5BDBE211958FE217859266C12013-06-22T21: 30: 49 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 270DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T22: 47: 22 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 280DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 09: 37 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 290DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 10: 38 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2A0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 16: 10 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2B0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 16: 29 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 2C0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 16: 29 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2D0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 17: 10 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2E0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 18: 37 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2F0DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 38: 45 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 300DD82C6CDBE2119FC8A7A32EE75CE72013-06-22T23: 41: 57 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B266298474DBE2119FC8A7A32EE75CE72013-06-22T23: 47: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B366298474DBE2119FC8A7A32EE75CE72013-06-22T23: 49: 33 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B466298474DBE2119FC8A7A32EE75CE72013-06-22T23: 50: 40 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B566298474DBE2119FC8A7A32EE75CE72013-06-22T23: 55: 12 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B666298474DBE2119FC8A7A32EE75CE72013-06-23T00: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B766298474DBE2119FC8A7A32EE75CE72013-06-23T00: 05: 35 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B866298474DBE2119FC8A7A32EE75CE72013-06-23T01: 14: 34 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BA66298474DBE2119FC8A7A32EE75CE72013-06-23T01: 53: 02 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BB66298474DBE2119FC8A7A32EE75CE72013-06-23T01: 55: 16 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: BC66298474DBE2119FC8A7A32EE75CE72013-06-23T01: 55: 16 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D32F5A0B88DBE2119FC8A7A32EE75CE72013-06-23T02: 06: 52 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: D42F5A0B88DBE2119FC8A7A32EE75CE72013-06-23T02: 06: 52 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 47B37D7545DCE2119F1FB898290AD8D42013-06-24T00: 47: 27 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savexmp.iid: 49B37D7545DCE2119F1FB898290AD8D42013-06-24T00: 57: 17 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4BB37D7545DCE2119F1FB898290AD8D42013-06-24T01: 07: 34 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4DB37D7545DCE2119F1FB898290AD8D42013-06-24T01: 17: 58 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4EB37D7545DCE2119F1FB898290AD8D42013-06-24T01: 18: 50 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: C344967F4ADCE2119F1FB898290AD8D42013-06-24T01: 18: 50 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C444967F4ADCE2119F1FB898290AD8D42013-06-24T01: 21: 12 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F70CE8F0FADFE211AED3D9604013A03A2013-06-28T17: 59: 25 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: F90CE8F0FADFE211AED3D9604013A03A2013-06-28T17: 59: 25 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FB0CE8F0FADFE211AED3D9604013A03A2013-06-28T18: 15: 35 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FD0CE8F0FADFE211AED3D9604013A03A2013-06-28T18: 30: 59 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FF0CE8F0FADFE211AED3D9604013A03A2013-06-28T19: 46: 10 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7E777B420AE0E211AED3D9604013A03A2013-06-28T19: 49: 04 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7F777B420AE0E211AED3D9604013A03A2013-06-28T19: 59: 58 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: AE951C0210E0E211AED3D9604013A03A2013-06-28T20: 30: 13 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 789B3BAF8DE1E211B486F5DE26BAEC232013-06-30T18: 50: 03 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 3F8A015994E1E211B486F5DE26BAEC232013-06-30T18: 50: 03 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 0ACF22D480E3E211B885DE28FAC0A85C2013-07-03T05: 35: 22 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: CCBA2ED480E3E211B885DE28FAC0A85C2013-07-03T05: 35: 22 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C9284E19D9E4E2118A3FCA0FBFCBECAA2013-07-04T22: 39: 45 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: F39D6319D9E4E2118A3FCA0FBFCBECAA2013-07-04T22: 39: 45 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F49D6319D9E4E2118A3FCA0FBFCBECAA2013-07-04T22: 49: 21 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 506653A4DAE4E2118A3FCA0FBFCBECAA2013-07-04T22: 50: 48 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 516653A4DAE4E2118A3FCA0FBFCBECAA2013-07-04T22: 54: 39 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 88B95E3DDBE4E2118A3FCA0FBFCBECAA2013-07-04T22: 55: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: ACFC5F61DBE4E2118A3FCA0FBFCBECAA2013-07-04T22: 56: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BA47649FDBE4E2118A3FCA0FBFCBECAA2013-07-04T22: 57: 49 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 6880530ADCE4E2118A3FCA0FBFCBECAA2013-07-04T23: 00: 49 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 945F87ABDCE4E2118A3FCA0FBFCBECAA2013-07-04T23: 05: 19 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C0EC4D96E1E4E2118A3FCA0FBFCBECAA2013-07-04T23: 40: 31 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 79920725E2E4E2118A3FCA0FBFCBECAA2013-07-04T23: 44: 30 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 25E61D4AE3E4E2118A3FCA0FBFCBECAA2013-07-04T23: 52: 42 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 674ED8C5E4E4E2118A3FCA0FBFCBECAA2013-07-05T00: 03: 19 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5906EAD5E6E4E2118A3FCA0FBFCBECAA2013-07-05T00: 18: 05 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E8C3E715E7E4E2118A3FCA0FBFCBECAA2013-07-05T00: 19: 53 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E9C3E715E7E4E2118A3FCA0FBFCBECAA2013-07-05T00: 20: 22 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: EAC3E715E7E4E2118A3FCA0FBFCBECAA2013-07-05T00: 20: 22 + 04: 00Adobe InDesign 7.5 /
  • savedxmp.iid: EBC3E715E7E4E2118A3FCA0FBFCBECAA2013-07-05T00: 30: 17 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: ECC3E715E7E4E2118A3FCA0FBFCBECAA2013-07-05T00: 34: 17 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: E0C33419E9E4E2118A3FCA0FBFCBECAA2013-07-05T00: 34: 17 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C11331D8D8F6E211B17D8F794FC7FFC32013-07-27T20: 23: 17 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: F9AF4DD8D8F6E211B17D8F794FC7FFC32013-07-27T20: 23: 17 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FAAF4DD8D8F6E211B17D8F794FC7FFC32013-07-27T20: 24: 18 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 06303247D9F6E211B17D8F794FC7FFC32013-07-27T20: 26: 23 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BA4BDD5DD9F6E211B17D8F794FC7FFC32013-07-27T20: 27: 01 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savexmp.iid: 74C804AAD9F6E211B17D8F794FC7FFC32013-07-27T20: 29: 09 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9CD05CE5D9F6E211B17D8F794FC7FFC32013-07-27T20: 30: 49 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1BCD5700DAF6E211B17D8F794FC7FFC32013-07-27T20: 31: 34 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 33B8201BDAF6E211B17D8F794FC7FFC32013-07-27T20: 32: 19 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 15FAE94ADAF6E211B17D8F794FC7FFC32013-07-27T20: 33: 39 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 79E29971DAF6E211B17D8F794FC7FFC32013-07-27T20: 34: 44 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9E0B2396DAF6E211B17D8F794FC7FFC32013-07-27T20: 35: 45 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 9F0B2396DAF6E211B17D8F794FC7FFC32013-07-27T20: 37: 17 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: A00B2396DAF6E211B17D8F794FC7FFC32013-07-27T20: 40: 03 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: DE369F91DBF6E211B17D8F794FC7FFC32013-07-27T20: 42: 47 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 09616CD2DBF6E211B17D8F794FC7FFC32013-07-27T20: 44: 36 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 30907D37DCF6E211B17D8F794FC7FFC32013-07-27T20: 47: 25 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 8D7D1343DCF6E211B17D8F794FC7FFC32013-07-27T20: 47: 45 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 33ADD14DE8F6E211B17D8F794FC7FFC32013-07-27T22: 13: 57 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 5F4D4F9FE8F6E211B17D8F794FC7FFC32013-07-27T22: 16: 14 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7BBF870EEAF6E211B17D8F794FC7FFC32013-07-27T22: 26: 30 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savexmp.iid: BA2290BDEAF6E211B17D8F794FC7FFC32013-07-27T22: 31: 23 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 98181EF2EAF6E211B17D8F794FC7FFC32013-07-27T22: 32: 51 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 98217FE6EBF6E211B17D8F794FC7FFC32013-07-27T22: 39: 41 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: DE95ABFFEBF6E211B17D8F794FC7FFC32013-07-27T22: 40: 24 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 680F1015ECF6E211B17D8F794FC7FFC32013-07-27T22: 41 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2EBAFA54ECF6E211B17D8F794FC7FFC32013-07-27T22: 42: 47 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: FCBF2A6AECF6E211B17D8F794FC7FFC32013-07-27T22: 43: 22 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EF4BB4BBECF6E211B17D8F794FC7FFC32013-07-27T22: 45: 39 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 09495305EDF6E211B17D8F794FC7FFC32013-07-27T22: 47: 43 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C7DBFFA7EDF6E211B17D8F794FC7FFC32013-07-27T22: 52: 16 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: B10AE91CEFF6E211B17D8F794FC7FFC32013-07-27T23: 02: 41 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 35DC0FD9F2F6E211B17D8F794FC7FFC32013-07-27T23: 29: 25 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 95D237E7F2F6E211B17D8F794FC7FFC32013-07-27T23: 29: 49 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: E742C0F5F9F6E211B17D8F794FC7FFC32013-07-28T00: 23: 01 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: AF3C3DF6FBF6E211B17D8F794FC7FFC32013-07-28T00: 34: 40 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: EC5A177EFCF6E211B17D8F794FC7FFC32013-07-28T00: 38: 28 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 32282106FDF6E211B17D8F794FC7FFC32013-07-28T00: 42: 16 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: A025C186FDF6E211B17D8F794FC7FFC32013-07-28T00: 45: 52 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: C828AD1101F7E211B17D8F794FC7FFC32013-07-28T01: 11: 13 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 801CC98A01F7E211B17D8F794FC7FFC32013-07-28T01: 14: 37 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 82B0D7768BFAE2118879AC410E6E74622013-08-01T13: 19: 27 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 84AE0EC78BFAE2118879AC410E6E74622013-08-01T13: 21: 42 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F14D486292FFE211ADF79D1F042C2C132013-08-07T22: 51: 35 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 4538736292FFE211ADF79D1F042C2C132013-08-07T22: 51: 35 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4638736292FFE211ADF79D1F042C2C132013-08-07T22: 52: 30 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2024DA9792FFE211ADF79D1F042C2C132013-08-07T22: 53: 05 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 765EEFBA92FFE211ADF79D1F042C2C132013-08-07T22: 54: 04 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 073CDDD192FFE211ADF79D1F042C2C132013-08-07T22: 54: 42 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 4521045294FFE211ADF79D1F042C2C132013-08-07T23: 05: 27 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 35B18B2B870BE3119278843516883A9F2013-08-23T04: 01: 33 + 04: 00Adobe InDesign 7.5 / метаданные
  • savedxmp.iid: 51FF992B870BE3119278843516883A9F2013-08-23T04: 01: 33 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 52FF992B870BE3119278843516883A9F2013-08-23T04: 23: 20 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 57DCDEC78D0BE3119278843516883A9F2013-08-23T04: 48: 52 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: BD781BFE900BE3119278843516883A9F2013-08-23T05: 11: 51 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 2FEFD69A910BE3119278843516883A9F2013-08-23T05: 16: 14 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1DE31AEE230CE3118FF4F9804560938F2013-08-23T22: 43: 40 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 7D6196EB2B0CE3118FF4F9804560938F2013-08-23T23: 40: 52 + 04: 00 Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: F65768CD320CE3118FF4F9804560938F2013-08-24T00: 30: 08 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • savedxmp.iid: 1A231D62340CE3118FF4F9804560938F2013-08-24T00: 41: 27 + 04: 00Adobe InDesign 7.5 /; / метаданные
  • xmp. Библиотека Adobe PDF 9.9FalsePDF / X-1: 2001PDF / X-1: 2001PDF / X-1a: 2001 конечный поток endobj 1018 0 объект > endobj 1021 0 объект > endobj 1173 0 объект > endobj 1175 0 объект > endobj 1176 0 объект > endobj 1177 0 объект > endobj 1215 0 объект > 1212 0 R] / P 1198 0 R / Pg 1218 0 R / S / Link >> endobj 1216 0 объект > 1214 0 R] / P 1183 0 R / Pg 1218 0 R / S / Link >> endobj 1183 0 объект > endobj 1218 0 объект > / MediaBox [0 0 442.08 663.12] / Parent 1024 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] / XObject >>> / StructParents 0 / Tabs / S / Type / Page >> endobj 1220 0 объект > поток x [n7} 7 ࣶeInM4i «(>; 3 \ 6 T

    Пролиферация желчных протоков как неожиданный побочный эффект после переноса гена AAV2-LDLR в печень кролика

    Производство вирусных векторов

    Конструкции векторов AAV2 и AAV9 LDLR содержали идентичные кассеты экспрессии кроличьего LDLR с синтетическим печеночно-специфическим α1-микроглобулином / бикунином (ABP) / тироидным гормон-связывающим глобулином (TBG) энхансером / промотором (LSP) ABP / TBG промотором 7 и LacZ использовали в качестве контроля ген.

    векторов AAV2 были получены, как описано ранее 28 с некоторыми модификациями. Вкратце, 293 Т-клетки трансфицировали векторной плазмидой AAV2 и вспомогательной плазмидой pDG (любезно предоставленной доктором Юргеном Кляйншмидтом, DKFZ, Гейдельберг, Германия) с преципитацией фосфатом кальция. Свежую среду меняли через 24 часа, а клетки собирали через 48-72 часа после трансфекции. Вирусный вектор высвобождался из клеток за 3 цикла замораживания-оттаивания. Затем среду, содержащую вектор, очищали центрифугированием в градиенте йодиксанола и аффинной хроматографией на гепарине.Фракции, содержащие очищенный вектор, собирали и подвергали диализу против PBS. Очищенный вектор хранили в PBS при -70 ° C до использования.

    векторов AAV9 получали в лаборатории разработки векторов в Калифорнийском университете в Калифорнии, как описано ранее 29 . Не содержащие хелперных вирусов векторы AAV9 получали путем временной трансфекции клеток HEK293T векторной плазмидой pRep2-Cap9 и плазмидой pAd-Helper 30 . Плазмида pRep2-Cap9 Плазмида была получена от доктора Уилсона (U. Penn). Клеточные лизаты, полученные через 72 часа после трансфекции, обрабатывали бензоназой, а вирусы осаждали с помощью ультрацентрифугирования на 25% сахарозной подушке.Осадки ресуспендировали, и вирусы дополнительно очищали с помощью анионообменной колоночной хроматографии (Q-Sepharose, GE Health Science) 31,32 с последующим концентрированием с помощью ультрацентрифугирования на 25% сахарозной подушке. Конечные осадки ресуспендировали в 10 мМ Трис-HCl, pH 7,9, 1 мМ MgCl2, 3% сахарозе. Титры вирусов определяли путем измерения копий генома с помощью Q-PCR в реальном времени с использованием ДНК вирусного генома, полученной из очищенных вирусных препаратов.

    LV векторов, кодирующих кроличий LDLR под транскрипционным контролем того же промотора ABP / TBG 33 , были продуцированы в 293 Т-клетках, как описано ранее. 7 и GFP использовали в качестве контрольного гена.

    Перенос гена in vivo

    кроликов WHHL (n = 54, самцы и самки; 2,5–3,5 кг) использовали для переноса гена in vivo AAV. Серотипы AAV2 и AAV9 использовали для инъекций воротной вены в печень кролика WWHL. В общей сложности 1 × 10 11 –1 × 10 12 мкг векторов AAV, разведенных в 2–5 мл 0,9% NaCl, вводили каждому животному каждого из следующих векторов: AAV2-LDLR (n = 8), AAV2 -контроль (n = 11), AAV9-LDLR (n = 15) и AAV9-контроль (n = 10).Для векторов LV использовали 1 × 10 9 МЕ (10 мкг gag-антигена p24) LV-LDLR (n = 6) и LV-контроль (n = 4) 7 .

    Вкратце, животных анестезировали кетамином (Кеталар 20 мг / кг, Pfizer) и медетомидином (Домитор 0,3 мг / кг, Орион, Финляндия). Выполнена лапаротомия, визуализирована воротная вена. Векторы вводили через канюлю 24G в портальный кровоток. После удаления канюли наблюдали за местом прокола, чтобы убедиться в отсутствии кровотечения, после чего лапаротомную рану закрыли в два слоя.Карпрофен (Римадил 4 мг / кг, Pfizer) применялся в качестве послеоперационного анальгетика. Животных умерщвляли через 1 месяц или 1 год после переноса гена.

    Клиническая химия

    Мониторинг аланинаминотрансферазы (АЛТ), щелочной фосфатазы (АФТ), аспартатаминотрансферазы, общего холестерина (общего холестерина), липопротеинов низкой плотности (ЛПНП), липопротеинов высокой плотности (ЛПВП) и триглицеридов (триглицериды) из образцов сыворотки натощак регулярно. Образцы собирали в начале исследования, а затем ежемесячно на протяжении всего исследования и анализировали в лаборатории ветеринарной службы MoVet (MoVet, Куопио, Финляндия).

    Гистология

    Образцы тканей для гистологического анализа были взяты во время умерщвления из печени, селезенки, скелетных мышц, сердца, гонад, легких и почек. Чтобы убедиться, что вся печень была точно представлена, были собраны образцы из четырех долей печени от каждого животного. Образцы фиксировали в 4% PFA-сахарозе, заливали парафином и нарезали срезы 7 мкм. Срезы окрашивали гематоксилин-эозином (HE) для анализа гистологии печени. Гистология оценивалась слепым методом гепатопатологом (В.K.) из 4–5 слайдов на печень, и изменения были классифицированы в соответствии с серьезностью и / или выраженностью каждого изменения от 0 до 3 34 . Показан средний балл для каждой группы лечения ± SEM.

    Иммуногистохимическое окрашивание проводили для макрофагов (1: 200, RAM-11; DAKO), пролиферирующих клеток (1: 200, Ki-67; DakoCytomation), Т-лимфоцитов кролика (1: 200; GenWay), Cyr61 (5 мкг). / мл; Cyr61, Novus Biologicals;), β-галактозидаза (1: 200; β-гал; Promega) и цитокератины (1: 200, пан-цитокератин, AE1 / AE3; Santa Cruz Biotechnology).Микрофотографии гистологических срезов 7 мкм были сделаны с помощью микроскопа Olympus AX70 (Olympus Optical) и программного обеспечения analySIS (Soft Imaging System). Далее изображения были обработаны для публикации в Adobe Photoshop 7.0 (Adobe).

    кПЦР и ОТ-кПЦР

    ДНК экстрагировали из быстро замороженных образцов ткани печени после обработки протеиназой К и экстрагировали фенол-хлороформом в соответствии со стандартными протоколами. Для тканей LV-LDLR ДНК выделяли из фиксированной формалином залитой парафином (FFPE) ткани, как ранее опубликовано 35 .Десять срезов по 10 мкм каждый из каждого образца FFPE использовали для выделения гДНК. ПЦР-амплификацию проводили на 50 или 500 нг (FFPE-образцы) геномной ДНК. Число копий вектора анализировали с использованием специального анализа TaqMan для промотора LSP (Applied Biosystems; прямой праймер 5′-GCCTCTGCTTTTTGTACAACTTTCC-3 ‘, обратный праймер 5′-AGTTCTCACTATTGGGCCAAACAG-3′ и зонд AAAACTGCCAATCCC) или PrimePCR ™ для пользовательского анализа Probe Probe Rad; прямой праймер 5’-ATACGCTGCTTTAATGCCTTTG-3 ‘, обратный праймер 5′-GGGCCACAACTCCTCATAAA-3′ и зонд TCATGCTATTGCTTCCCGTATGGCT) и 2x Universal Master Mix.КПЦР в реальном времени выполняли в ABI Step One Plus Prism 7700, а данные анализировали с помощью соответствующего программного обеспечения (Applied Biosystems). Предел обнаружения для пользовательских анализов был определен с использованием плазмидной ДНК с известным числом копий-мишеней с добавлением 50 нг геномной ДНК и был определен как 10 копий. РНК выделяли из быстро замороженных образцов ткани с помощью TRI-реагента (Sigma Aldrich) в соответствии с инструкциями производителя. Всего 1 мкг РНК использовали для синтеза кДНК после обработки ДНКазой (набор Turbo DNA free RNA; Thermo Fischer Scientific) с использованием случайных гексамерных праймеров (Promega) и Revert Aid ™ (Thermo Fischer Scientific).Относительные уровни экспрессии Cyr61 и rLDLR в образцах печени из разных групп лечения измеряли в соответствии с протоколом производителей с использованием либо анализа Cyr61 PrimePCR ™ для кроликов (Bio-Rad; идентификатор анализа: qOcuCEP0031536), либо пользовательского анализа PrimeTime qPCR Probe для кроликов LDLR (IDT ДНК; прямой праймер 5’-GTATCTCCTACAAGTGGGTGTG-3 ‘, обратный праймер 5′-GACTTGCAGGTGAGA GACAT-3’и зонд / 56-FAM / CG GCT CGG A / Zen / C GAG TGG GAG CAG / 3IABkFQan /) универсальная 2х ПЦР смесь (Life Technology).Уровни экспрессии были нормализованы до ActB кролика (IDT ДНК; прямой праймер 5’-GGACCTGACCGACTACCT-3 ‘, обратный праймер 5′-GTAGCACAGCTTCTCCTTGAT-3’ и зонд / 56-FAM / ATGAAGATC / Zen / CTCACGGAGCGCG / 3IABkFQ /).

    Статистический анализ

    Результаты выражены в виде среднего значения ± SEM. Статистическая значимость анализировалась с помощью однофакторного дисперсионного анализа с последующим тестом множественного сравнения Тьюки или t-критерием Стьюдента, где это необходимо (GraphPad Prism). Данные клинической химии были проанализированы с помощью линейной модели смешанных эффектов с использованием статистического программного обеспечения R, изучив влияние группы, лечения и времени на ответ (Фонд статистических вычислений, Вена, Австрия, версия 3.{\ text {‘}}} \ beta + {u} _ {i} + {e} _ {ij} $$

    , где u i — нормально распределенные случайные эффекты с нулевым средним и постоянной дисперсией, а e ij — это остаток с нулевым средним. В случае непостоянной дисперсии дисперсия остаточных ошибок моделировалась соответствующей функцией дисперсии, а ковариации между членами ошибки для конкретного кролика моделировались с использованием процесса AR1 или AR2, если необходимо.

    Фиксированная часть включает уровни группы (AAV2, AAV9 или LV) или два уровня лечения (LDLR и контроль) и функцию времени.В модели влияние времени моделировалось с помощью естественных сплайнов с четырьмя узлами в моменты времени 3, 5, 7 и 10 36 . Взаимодействия между функцией сплайна и группой или лечением также были включены в модели. Значение p ниже 0,05 считалось статистически значимым.

    Одобрение исследования

    Все эксперименты на животных были одобрены Советом по экспериментам на животных в Финляндии и проводились в соответствии с Законом Финляндии об экспериментах на животных. Исследование соответствует Руководству по уходу и использованию лабораторных животных , опубликованному Национальными институтами здравоохранения США (публикация NIH No.85-23, переработано в 1996 г.).

    Дизайн, разработка и терапия лекарств | Том 8

    Оригинальные исследования

    Ксилокетал B, морское соединение, действует на сеть молекулярных белков и регулирует активность и экспрессию цитохрома P450 3a крысы: биоинформатическое исследование и исследование на животных

    Су Дж. Х., Чанг Ц., Сян Ц., Чжоу З. В., Ло Р, Ян Л., Хе З. X, Ян Х. Т., Ли Дж., Бей И, Сюй Дж. М., Чжан М. Дж., Чжан К. Х., Су З. Дж., Хуан Ю. Д., Панг Дж. SF

    Дизайн, разработка и терапия лекарств 2014, 8: 2555-2602

    Дата публикации: 12 декабря 2014 г.

    Оригинальные исследования

    Лечение пятен портвейна импульсным лазером на красителе: ретроспективное исследование 848 случаев в провинции Шаньдун, Китайская Народная Республика

    Ши В, Ван Дж, Линь И, Гэн Дж, Ван Х, Гонг И, Лю Х, Чжан Ф

    Дизайн, разработка и терапия лекарств 2014, 8: 2531-2538

    Дата публикации: 12 декабря 2014 г.

    Оригинальные исследования

    Последовательная обработка AT-101 повышает химиочувствительность цисплатина в клетках немелкоклеточного рака легких человека за счет ингибирования сигнального пути IL-6 / STAT3, активируемого апуриновой / апиримидиновой эндонуклеазой 1

    Ren T, Shan J, Qing Y, Qian C, Li Q, Lu G, Li M, Li C, Peng Y, Luo H, Zhang S, Zhang W, Wang D, Zhou SF

    Дизайн, разработка и терапия лекарств 2014, 8: 2517-2529

    Дата публикации: 12 декабря 2014 г.

    Оригинальные исследования

    Генная терапия NK4 на основе мезенхимальных стволовых клеток у голых мышей с ксенотрансплантатами рака желудка

    Zhu Y, Cheng M, Yang Z, Zeng CY, Chen J, Xie Y, Luo SW, Zhang KH, Zhou SF, Lu NH

    Дизайн, разработка и терапия лекарств 2014, 8: 2449-2462

    Дата публикации: 9 декабря 2014 г.

    Оригинальные исследования

    Матрично-индуцированная имплантация аутологичных хондроцитов для лечения хондральных дефектов коленных суставов у пациентов из Китая

    Zhang ZW, Zhong X, Ji HR, Tang ZB, Bai JP, Yao MM, Hou JL, Zheng MH, Wood D, Sun JZ, Zhou SF, Liu AB

    Дизайн, разработка и терапия лекарств 2014, 8: 2439-2448

    Дата публикации: 5 декабря 2014 г.

    Оригинальные исследования

    Гипонатриемия, индуцированная цисплатином при злокачественных новообразованиях: сравнение фирменного препарата и генерического препарата

    Ochi N, Yamane H, Hotta K, Fujii H, Isozaki H, Honda Y, Yamagishi T, Kubo T, Tanimoto M, Kiura K, Takigawa N

    Дизайн, разработка и терапия лекарств 2014, 8: 2401-2408

    Дата публикации: 3 декабря 2014 г.

    Оригинальные исследования

    CCL19 и CCL21 модулируют воспалительную среду в атеросклеротических поражениях.

    Akhavanpoor M, Gleissner CA, Gorbatsch S, Doesch AO, Akhavanpoor H, Wangler S, Jahn F, Lasitschka F, Katus HA, Erbel C

    Дизайн, разработка и терапия лекарств 2014, 8: 2359-2371

    Дата публикации: 27 ноября 2014 г.

    Оригинальные исследования

    Ранняя нестабильная популяционная фармакокинетика перорального циклоспорина у реципиентов почечного трансплантата

    Пэк Х, Хан С., Йим Д.С., Ким С.Дж., Ли С.И., Джанг Х.Р., Ли Дж.Э., Ким Диджей, Ким Й.Г., О, привет, Ха В.

    Дизайн, разработка и терапия лекарственных средств, 2014 г., 8: 2241-2249

    Дата публикации: 7 ноября 2014 г.

    Оригинальные исследования

    Участие сигнальных путей NF-B и HSP70 в апоптозе клеток MDA-MB-231, индуцированном пренилированным ксантоновым соединением, α-мангостином, из Cratoxylum arborescens

    Ибрагим М.Ю., Хашим Н.М., Мохан С., Абдулла М.А., Абдельвахаб С.И., Камалидехган Б., Гадериан М., Дехган Ф., Али Л.З., Каримиан Х., Яхаю М., Ee GCL, Фарджам А.С., Али Х.М.

    Дизайн, разработка и терапия лекарств 2014, 8: 2193-2211

    Дата публикации: 6 ноября 2014 г.

    Оригинальные исследования

    Открытие и оценка новых противовоспалительных производных натурального биоактивного куркумина.

    Чжан И, Цзян Х, Пэн К., Чен Ц, Фу Л, Ван З, Фэн Дж, Лю З, Чжан Х, Лян Дж, Пан З

    Дизайн, разработка и терапия лекарств 2014, 8: 2161-2171

    Дата публикации: 4 ноября 2014 г.

    Оригинальные исследования

    Исследования противоопухолевой эффективности и абсорбции, распределения, метаболизма и токсичности аспергиолида А на ранних этапах разработки лекарств

    Ван И, Ци Х, Ли Д, Чжу Т, Мо Икс, Ли Дж.

    Дизайн, разработка и терапия лекарств 2014, 8: 1965-1977

    Дата публикации: 17 октября 2014 г.

    Оригинальные исследования

    Кишечная абсорбция, распределение по органам и экскреция редкого сахара D-псикозы с мочой

    Цукамото И., Хосейн А., Ямагути Ф., Хирата Й, Донг Й, Камитори К., Суй Л., Нонака М., Уэно М., Нисимото К., Суда Х., Моримото К., Шимониси Т., Сайто М., Сон Т, Кониси Р., Токуда M

    Дизайн, разработка и терапия лекарств 2014, 8: 1955-1964

    Дата публикации: 17 октября 2014 г.

    Оригинальные исследования

    Индол и его синтетические производные активируют экспрессию шаперона для уменьшения агрегации полиQ в моделях нейрональных клеток и срезов SCA17.

    Kung PJ, Tao YC, Hsu HC, Chen WL, Lin TH, Janreddy D, Yao CF, Chang KH, Lin JY, Su MT, Wu CH, Lee-Chen GJ, Hsieh-Li HM

    Дизайн, разработка и терапия лекарств 2014, 8: 1929-1939

    Дата публикации: 16 октября 2014 г.

    Оригинальные исследования

    Мультипотентные ингибиторы холинэстеразы / моноаминоксидазы для лечения болезни Альцгеймера: дизайн, синтез, биохимическая оценка, ADMET, молекулярное моделирование и анализ QSAR новых гибридов донепезил-пиридил

    Баутиста-Агилера О.М., Эстебан Г., Чиуа М., Николич К., Агбаба Д., Мораледа I, Ириепа I, Сориано Э, Самади А, Унзета М., Марко-Контеллес J

    Дизайн, разработка и терапия лекарств 2014, 8: 1893-1910

    Дата публикации: 13 октября 2014 г.

    Оригинальные исследования

    Синтез и биологическая оценка новых производных индол-2-она и 7-аза-2-оксиндола в качестве противовоспалительных средств

    Чен Дж, Цзян Л., Донг Л., Ван З., Сюй Ф, Дин Т, Фу Л., Фанг Ц., Лю З., Шань Х, Лян Г.

    Дизайн, разработка и терапия лекарств 2014, 8: 1869-1892

    Дата публикации: 13 октября 2014 г.

    Оригинальные исследования

    Система высвобождения мощного нацеленного на опухоль лекарственного средства, содержащая фрагмент пептида, специфичного для MMP-2, с характеристиками самосборки

    Хуа Д., Конг В., Чжэн Х, Чжоу З, Ю Б, Ли И, Ван И, Ян Х, Лю Ц., Тан Л, Ли И, Гонг М

    Дизайн, разработка и терапия лекарств 2014, 8: 1839-1849

    Дата публикации: 14 октября 2014 г.

    Оригинальные исследования

    Влияние перорального аллостерического ингибитора AKT (MK-2206) на рак носоглотки у человека in vitro и in vivo

    Чжао Й., Тиан И, Чжан Дж., Сюй Ф., Ян Ю.П., Хуан И, Чжао Х.Й., Чжан Дж.В., Сюэ С, Лам М.Х., Янь Л., Ху Чж, Динглин ХХ, Чжан Л.

    Дизайн, разработка и терапия лекарств 2014, 8: 1827-1837

    Дата публикации: 10 октября 2014 г.

    Оригинальные исследования

    Ингаляционные ингибиторы тирозинкиназы при легочной гипертензии: возможное лечение в будущем

    Pitsiou G, Zarogoulidis P, Petridis D, Kioumis I, Lampaki S, Organtzis J, Porpodis K, Papaiwannou A, Tsiouda T., Hohenforst-Schmidt W., Kakolyris S, Syrigos K, Huang H, Li Q, Turner JF, Zarogoulidis

    Дизайн, разработка и терапия лекарств 2014, 8: 1753-1763

    Дата публикации: 7 октября 2014 г.

    Оригинальные исследования

    Влияние функции почек на фармакокинетику фимасартана: открытое исследование фазы I с однократной дозой

    Kim S, Lee J, Shin D, Lim KS, Kim YS, Jang IJ, Yu KS

    Дизайн, разработка и терапия лекарств 2014, 8: 1723-1731

    Дата публикации: 6 октября 2014 г.

    Оригинальные исследования

    Фармакокинетика и фармакодинамика многократного введения эвоглиптина (DA-1229), нового ингибитора дипептидилпептидазы IV, у здоровых добровольцев

    Гу Н, Пак М.К., Ким ТЕ, Банг М.И., Лим К.С., Чо Ш, Юн Ш, Чо Джи, Чан АйДжей, Ю К.С.

    Дизайн, разработка и терапия лекарств 2014, 8: 1709-1721

    Дата публикации: 6 октября 2014 г.

    Оригинальные исследования

    Влияние иммуносупрессивной терапии на экспрессию белка в почках крысы

    Kędzierska K, Sporniak-Tutak K, Sindrewicz K, Bober J, Domański L, Parafiniuk M, Urasińska E, Ciechanowicz A, Domański M, Smektała T, Masiuk M, Skrzypczak W, Ożgo Kopers

    Дизайн, разработка и терапия лекарств 2014, 8: 1695-1708

    Дата публикации: 30 сентября 2014 г.

    Оригинальные исследования

    α-Мангостин из Cratoxylum arborescens демонстрирует апоптогенез в MCF-7 с регуляцией модуляции белков NF-κB и Hsp70 in vitro и уменьшением опухоли in vivo.

    Ибрагим М.Ю., Хашим Н.М., Мохан С., Абдулла М.А., Камалидехган Б., Гадериан М., Дехган Ф., Али Л.З., Арбаб И.А., Яхаю М., Лиан Г.Э., Ахмадипур Ф., Али Х.М.

    Дизайн, разработка и терапия лекарств 2014, 8: 1629-1647

    Дата публикации: 27 сентября 2014 г.

    Оригинальные исследования

    Фармакокинетика и переносимость нового ненуклеозидного ингибитора обратной транскриптазы второго поколения KM-023 у здоровых людей

    Cha YJ, Lim KS, Park MK, Schneider S, Bray B, Kang MC, Chung JY, Yoon SH, Cho JY, Yu KS

    Дизайн, разработка и терапия лекарств 2014, 8: 1613-1619

    Дата публикации: 26 сентября 2014 г.

    Оригинальные исследования

    Ferulago angulata активирует внутренний путь апоптоза в клетках MCF-7, связанный с остановкой клеточного цикла G1, через участие p21 / p27

    Каримиан Х, Могхадамтуси С.З., Фадаинасаб М, Голбабапур С., Разави М., Хаджрезайе М., Арья А., Абдулла М.А., Мохан С., Али Х.М., Нордин Мичиган

    Дизайн, разработка и терапия лекарств 2014, 8: 1481-1497

    Дата публикации: 22 сентября 2014 г.

    Оригинальные исследования

    Взаимосвязь между временем и дозой между гепатотоксичностью, вызванной схизандрином B и маслом лимонника, и связанным с этим повышением уровней триглицеридов в печени и сыворотке крови у мышей

    Zhang Y, Pan SY, Zhou SF, Wang XY, Sun N, Zhu PL, Chu ZS, Yu ZL, Ko KM

    Дизайн, разработка и терапия лекарств 2014, 8: 1429-1439

    Дата публикации: 19 сентября 2014 г.

    Оригинальные исследования

    Превосходный профиль отторжения в течение первых 24 месяцев после трансплантации сердца при использовании такролимуса в качестве базовой иммуносупрессивной схемы

    Helmschrott M, Beckendorf J, Akyol C, Ruhparwar A, Schmack B, Erbel C, Gleissner CA, Akhavanpoor M, Ehlermann P, Bruckner T, Katus HA, Doesch AO

    Дизайн, разработка и терапия лекарств 2014, 8: 1307-1314

    Дата публикации: 9 сентября 2014 г.

    Оригинальные исследования

    Эффективность и безопасность иммуносупрессивной терапии при лечении апластической анемии, связанной с серонегативным гепатитом

    Chen HF, Xu BX, Shen HS, Li ZY, Jin LJ, Tang JQ, Wang J, Zhu JJ, Qin LM, Cui QY, Ren YY, Wu TQ

    Дизайн, разработка и терапия лекарств 2014, 8: 1299-1305

    Дата публикации: 9 сентября 2014 г.

    Оригинальные исследования

    Сероводород, потенциально новое лекарство, ослабляет гепатит, вызванный конканавалином А.

    Cheng P, Chen K, Xia Y, Dai WQ, Wang F, Shen M, Wang C, Yang J, Zhu R, Zhang H, Li JJ, Zheng Y, Wang J, Zhang Y, Lu J, Zhou YQ, Guo

    CY

    Дизайн, разработка и терапия лекарств 2014, 8: 1277-1286

    Дата публикации: 9 сентября 2014 г.

    Оригинальные исследования

    N-н-бутилгалоперидол йодид ингибирует индуцированную h3O2 активацию Na + / Ca2 + -обменника через обменник Na + / H + в миоцитах желудочков крыс

    Хуан Ю.П., Гао ФФ, Ван Б., Чжэн ФК, Чжан Ю.М., Чен Ю.С., Хуанг ЗК, Чжэн Ю.С., Чжун С.П., Ши Г.Г.

    Дизайн, разработка и терапия лекарств 2014, 8: 1257-1267

    Дата публикации: 9 сентября 2014 г.

    Оригинальные исследования

    Микрокапсулирование как новый метод доставки потенциального противодиабетического препарата Пробукол

    Мураниан А., Негрулдж Р., Чен-Тан Н., Аль-Саллами Х.С., Фанг З., Муккур Т.К., Миков М., Голокорбин-Кон С., Фахури М., Уоттс Г.Ф., Мэтьюз В., Арфусо Ф., Аль-Салями Н.

    Дизайн, разработка и терапия лекарств 2014, 8: 1221-1230

    Дата публикации: 9 сентября 2014 г.

    Оригинальные исследования

    Комбинация моделирования фармакофора на основе структуры, виртуального скрининга и анализа in silico ADMET для открытия новых активаторов изофермента M2 пируваткиназы на основе тетрагидрохинолина с противоопухолевой активностью

    Chen C, Wang T, Wu F, Huang W, He G, Ouyang L, Xiang M, Peng C, Jiang Q

    Дизайн, разработка и терапия лекарств 2014, 8: 1195-1210

    Дата публикации: 2 сентября 2014 г.

    Оригинальные исследования

    Влияние введения воды, обогащенной O2, путем инъекции или электролиза на чрескожное давление кислорода у анестезированных свиней

    Charton A, Péronnet F, Doutreleau S, Lonsdorfer E, Klein A, Jimenez L, Geny B, Diemunsch P, Richard R

    Дизайн, разработка и терапия лекарств 2014, 8: 1161-1167

    Дата публикации: 26 августа 2014 г.

    Оригинальные исследования

    Прогностическая эффективность номограмм дозирования гентамицина

    Ли Дж, Юн С., Шин Ди, Хан Х, Ан Х, Ли Дж, Лим К.С., Ю К.С., Ли Х.

    Дизайн, разработка и терапия лекарств 2014, 8: 1097-1106

    Дата публикации: 16 августа 2014 г.

    Оригинальные исследования

    Безопасность и эффективность химиотерапии S-1 у пациентов с рецидивирующей и метастатической карциномой носоглотки после неэффективности химиотерапии на основе платины: мультиинституциональный ретроспективный анализ

    Peng PJ, Cheng H, Ou XQ, Zeng LJ, Wu X, Liu YM, Lin Z, Tang YN, Wang SY, Zhang HY, Chen ZB

    Дизайн, разработка и терапия лекарств 2014, 8: 1083-1087

    Дата публикации: 14 августа 2014 г.

    Оригинальные исследования

    Оптимизация небулайзерной доставки аэрозолей линезолида, даптомицина и ванкомицина

    Zarogoulidis P, Kioumis I, Lampaki S, Organtzis J, Porpodis K, Spyratos D, Pitsiou G, Petridis D, Pataka A, Huang H, Li Q, Yarmus L, Hohenforst-Schmidt W., Pezirkianidis N, Zarogoulidis K

    Дизайн, разработка и терапия лекарств 2014, 8: 1065-1072

    Дата публикации: 12 августа 2014 г.

    Оригинальные исследования

    Дизайн, синтез и противораковая активность новых производных берберина, полученных с помощью химии «щелчка» CuAAC, в качестве потенциальных противораковых агентов.

    Цзинь X, Янь TH, Ян Л., Ли Цюй, Ван Р.Л., Ху З.Л., Цзян YY, Сунь Цюй, Цао ИБ

    Дизайн, разработка и терапия лекарств 2014, 8: 1047-1059

    Дата публикации: 6 августа 2014 г.

    Оригинальные исследования

    Антимикобактериальные, антимикробные свойства и биосовместимость пара-аминосалициловой кислоты со слоистым гидроксидом цинка и нанокомпозитами из слоистого двойного гидроксида Zn / Al

    Сайфулла Б., Эль-Зовалати МЭ, Арулсельван П., Факурази С., Вебстер Т.Дж., Гейлих Б.М., Хусейн MZ

    Дизайн, разработка и терапия лекарств 2014, 8: 1029-1036

    Дата публикации: 28 июля 2014 г.

    Оригинальные исследования

    Новая искусственная клеточная микрокапсуляция сложной композиции гликлазид-дезоксихолевая желчная кислота: исследование характеристик

    Мураниан А., Негрулдж Р., Чен-Тан Н., Аль-Саллами Х.С., Фанг З., Муккур Т., Миков М., Голокорбин-Кон С., Фахури М., Арфусо Ф, Аль-Салями Н.

    Дизайн, разработка и терапия лекарств 2014, 8: 1003-1012

    Дата публикации: 28 июля 2014 г.

    Оригинальные исследования

    Характеристики нагрузки и высвобождения на прочном катионном ионообменном волокне: кинетика, термодинамика и влияния

    Юань Дж, Гао И, Ван Х, Лю Х, Че Х, Сюй Л, Ян И, Ван Цюй, Ван И, Ли С

    Дизайн, разработка и терапия лекарств 2014, 8: 945-955

    Дата публикации: 16 июля 2014 г.

    Ретракция

    Наночастицы хитозана, модифицированные глицирретиновой кислотой, усиливали эффект 5-фторурацила на модели рака печени мышей через регуляторные Т-клетки [Retraction]

    Cheng M, Xu H, Wang Y, Chen H, He B, Gao X, Li Y, Han J, Zhang Z

    Дизайн, разработка и терапия лекарств 2014, 8: 921-922

    Дата публикации: 8 июля 2014 г.

    История болезни

    Вирусологический прорыв у пациента с хроническим гепатитом В путем комбинированного лечения тенофовир дизопроксилфумаратом и энтекавиром

    Suzuki F, Sezaki H, Akuta N, Suzuki Y, Kawamura Y, Hosaka T, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Kobayashi M, Watahiki S, Mineta R, Suzuki Y, Kumada H

    Дизайн, разработка и терапия лекарств, 2014, 8: 869-873

    Дата публикации: 30 июня 2014 г.

    Оригинальные исследования

    Новый нанокристаллический состав мегестрола ацетата имеет улучшенную биодоступность по сравнению с обычным микронизированным составом в состоянии натощак.

    Jang K, Yoon S, Kim SE, Cho JY, Yoon SH, Lim KS, Yu KS, Jang IJ, Lee H

    Дизайн, разработка и терапия лекарств 2014, 8: 851-858

    Дата публикации: 25 июня 2014 г.

    Оригинальные исследования

    Аддитивные эффекты цилнидипина, блокатора кальциевых каналов L- / N-типа и блокатора рецепторов ангиотензина II, на снижение кардиоренального повреждения у крыс Otsuka Long-Evans Tokushima Fatty с сахарным диабетом 2 типа

    Мори Й, Аритоми С., Нийнума К., Накамура Т., Мацуура К., Йокояма Дж., Уцуномия К.

    Дизайн, разработка и терапия лекарств 2014, 8: 799-810

    Дата публикации: 17 июня 2014 г.

    Обзор

    Ивабрадин, ишемическая болезнь сердца и сердечная недостаточность: вне контроля ритма

    Scicchitano P, Cortese F, Ricci G, Carbonara S, Moncelli M, Iacoviello M, Cecere A, Gesualdo M, Zito A, Caldarola P, Scrutinio D, Lagioia R, Riccioni G, Ciccone MM

    Дизайн, разработка и терапия лекарств 2014, 8: 689-700

    Дата публикации: 3 июня 2014 г.

    Оригинальные исследования

    Нейротерапевтическая активность рекомбинантного белка теплового шока Hsp70 на модели очаговой ишемии головного мозга у крыс

    Шевцов М.А., Николаев Б.П., Яковлева Л.Ю., Добродумов А.В., Дайнеко А.С., Шмонин А.А., Власов Т.Д., Мельникова Е.В., Вилисов А.Д., Гужова И.В., Ищенко А.М., Михрина А.Л., Галибин О.В., Яковенко И.В., Маргулис Б.А.

    Дизайн, разработка и терапия лекарств 2014, 8: 639-650

    Дата публикации: 28 мая 2014 г.

    Оригинальные исследования

    Хиноксалин-замещенные халконы как новые ингибиторы белка устойчивости к раку молочной железы ABCG2: полиспецифичность в положении B-кольца

    Winter E, Gozzi GJ, Chiaradia-Delatorre LD, Daflon-Yunes N, Terreux R, Gauthier C, Mascarello A, Leal PC, Cadena SM, Yunes RA, Nunes RJ, Creczynski-Pasa TB, Di Pietro A

    Дизайн, разработка и терапия лекарств 2014, 8: 609-619

    Дата публикации: 27 мая 2014 г.

    Исправление

    Профиль гантенерумаба и его потенциал в лечении болезни Альцгеймера [Corrigendum]

    Новакович Д., Фелиджиони М, Скаччаноче С., Карузо А, Пиччинин S, Шепизи С, Эррико Ф, Меркури Н.Б., Николетти Ф, Нистико R

    Дизайн, разработка и терапия лекарств 2014, 8: 569-570

    Дата публикации: 21 мая 2014 г.

    Оригинальные исследования

    Влияние совместного приема MMX® мезаламин на фармакокинетику амоксициллина, ципрофлоксацина XR, метронидазола и сульфаметоксазола: результаты четырех рандомизированных клинических испытаний

    Пирс Д., Коркоран М., Мартин П., Барретт К., Инглис С., Престон П., Томпсон Т.Н., Уилси С.К.

    Дизайн, разработка и терапия лекарств 2014, 8: 529-543

    Дата публикации: 14 мая 2014 г.

    Оригинальные исследования

    Влияние сулодексида на клинические и молекулярные параметры у пациентов со смешанными артериальными и венозными язвами нижних конечностей

    Serra R, Gallelli L, Conti A, De Caridi G, Massara M, Spinelli F, Buffone G, Caliò FG, Amato B, Ceglia S, Spaziano G, Scaramuzzino L, Ferrarese AG, Grande R, de Franciscis S

    Дизайн, разработка и терапия лекарств 2014, 8: 519-527

    Дата публикации: 13 мая 2014 г.

    Оригинальные исследования

    Синтез, противомикробная и противовоспалительная активность новых S-замещенных и N-замещенных 5- (1-адамантил) -1,2,4-триазол-3-тиолов

    Аль-Абдулла Э.С., Асири Х. Х., Лахсасни С., Хабиб Э. Э., Ибрагим ТМ, Эль-Эмам АА

    Дизайн, разработка и терапия лекарств 2014, 8: 505-518

    Дата публикации: 12 мая 2014 г.

    Оригинальные исследования

    Трансдермальный фентанил от боли из-за вызванного химиолучевой терапией мукозита полости рта у пациентов с раком носоглотки: оценка эффективности, безопасности и улучшения качества жизни

    Guo SP, Wu SG, Zhou J, Feng HX, Li FY, Wu YJ, Sun JY, He ZY

    Дизайн, разработка и терапия лекарств 2014, 8: 497-503

    Дата публикации: 12 мая 2014 г.

    Оригинальные исследования

    Выявление новой потенциальной противоопухолевой активности госсипола как ингибитора APE1 / Ref-1

    Цянь CY, Li MX, Sui JD, Ren T, Li Z, Zhang L, Zhou LW, Cheng Y, Wang D

    Дизайн, разработка и терапия лекарств, 2014 г., 8: 485-496

    Дата публикации: 9 мая 2014 г.

    Оригинальные исследования

    Ингибирование B7-1 (CD80) с помощью RhuDex® снижает липополисахаридное воспаление в атеросклеротических поражениях человека.

    Doesch AO, Zhao L, Gleissner CA, Akhavanpoor M, Rohde D, Okuyucu D, Hakimi M, Dengler TJ, Katus HA, Erbel C

    Дизайн, разработка и терапия лекарств 2014, 8: 447-457

    Дата публикации: 12 мая 2014 г.

    Оригинальные исследования

    Производные триазола с улучшенной противогрибковой активностью in vitro по сравнению с азольными препаратами

    Yu S, Chai X, Wang Y, Cao Y, Zhang J, Wu Q, Zhang D, Jiang Y, Yan T, Sun Q

    Дизайн, разработка и терапия лекарств 2014, 8: 383-390

    Дата публикации: 10 апреля 2014 г.

    Оригинальные исследования

    Открытие и оценка асимметричных монокарбонильных аналогов куркумина в качестве противовоспалительных средств.

    Чжан И, Чжао Ц., Хе В, Ван З., Фанг Ц., Сяо Б., Лю Ц., Лян Г, Ян С.

    Дизайн, разработка и терапия лекарств 2014, 8: 373-382

    Дата публикации: 4 апреля 2014 г.

    Обзор

    Тоцилизумаб в лечении ревматоидного артрита и не только

    Shetty A, Hanson R, Korsten P, Shawagfeh M, Arami S, Volkov S, Vila O, Swedler W, Shunaigat AN, Smadi S, Sawaqed R, Perkins D, Shahrara S, Sweiss NJ

    Дизайн, разработка и терапия лекарств 2014, 8: 349-364

    Дата публикации: 28 марта 2014 г.

    Оригинальные исследования

    Объединение римонабанта и фентанила в одном устройстве: препарат и фармакологические результаты

    Фернандес-Фернандес К., Калладо Л.Ф., Хирон Р., Санчес Э., Эрдосайн А.М., Лопес-Морено Х.А., Моралес П., Родригес де Фонсека Ф., Фернандес-Руис Дж., Гойя П., Меана Д.Дж., Мартин Н.М.

    Дизайн, разработка и терапия лекарств 2014, 8: 263-277

    Дата публикации: 20 февраля 2014 г.

    Оригинальные исследования

    Эффективность и безопасность фебуксостата при лечении гиперурикемии у стабильных реципиентов трансплантата почки

    Sofue T, Inui M, Hara T, Nishijima Y, Moriwaki K, Hayashida Y, Ueda N, Nishiyama A, Kakehi Y, Kohno M

    Дизайн, разработка и терапия лекарств 2014, 8: 245-253

    Дата публикации: 17 февраля 2014 г.

    Оригинальные исследования

    Влияние дополнительной терапии вилдаглиптином к метформину на асимметричный диметиларгинин в плазме у пациентов с сахарным диабетом 2 типа

    Cakirca M, Karatoprak C, Zorlu M, Kiskac M, Kanat M, Cikrikcioglu MA, Soysal P, Hursitoglu M, Camli AA, Erkoc R, Abdul-Ghani M

    Дизайн, разработка и терапия лекарств 2014, 8: 239-243

    Дата публикации: 14 февраля 2014 г.

    Оригинальные исследования

    Синоназальное вдыхание вибрирующего аэрозоля тобрамицина у пациентов с муковисцидозом и колонизацией верхних дыхательных путей Pseudomonas aeruginosa: результаты рандомизированного двойного слепого плацебо-контролируемого пилотного исследования

    Mainz JG, Schädlich K, Schien C, Michl R, Schelhorn-Neise P, Koitschev A, Koitschev C, Keller PM, Riethmüller J, Wiedemann B, Beck JF

    Дизайн, разработка и терапия лекарств 2014, 8: 209-217

    Дата публикации: 10 февраля 2014 г.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *